Answered: chances two people heterozygous for…

chances two people heterozygous for achondroplasia could have a normal child? alternate forms of a gene is called which molecules are required for translation

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter16: Reproductive Technology, Genetic Testing, And Gene Therapy

Section: Chapter Questions

Problem 16QP: A couple has had a child born with neurofibromatosis. They come to your genetic counseling office...

See similar textbooks

Related questions

Q: At which level of gene regulation shown in Figure 16.1 does attenuation occur?

A: Attenuation is a process which involves a presence of a stop signal which suggests premature…

Q: Gene A Gene B Gene C Low levels of gene A transcription generates some transcripts of the gene. No…

A: A gene is a fundamental unit of heredity and a sequence of nucleotides in DNA or RNA that encodes…

Q: What genetic material in a living cell which is single stranded involved in the coding of genes for…

A: The flow of information in cells takes place from transcription to translation. The translation is…

Q: After transcription, how is mRNA processed in eukaryotes? (Choose all that apply) 3' polyA tail is…

A: TRANSCRIPTION It is the formation of mRNA from DNA. The mRNA formed has to undergo various…

Q: What stops the translation process? when a stop codon on the mRNA enters the A site when a stop…

A: There are three types of stop codons which are present in m RNA and when they are encountered the…

Q: Which of the following happens during transcription? RNA polymerase uses DNA as a pattern to…

A: There are several molecular events that take place inside the cells. They involve replication of…

Q: Which of the following is not a control for translation? Methylation of DNA promotor Increase the…

A: Translation takes place in the cytoplasm (eukaryotes) where the mature mRNA is converted into chain…

Q: Which type of chemical bond is responsible for RNA-DNA base pairing during reverse transcription?…

A: The DNA and RNA nucleic acids that is composed of nucleotides. The nucleoitides are made up of…

Q: which of the following statements is correct? A proteins make MRNA which then makes genes B genes…

A: Protein synthesis is the essential metabolism occurring in all livings; proteins are made from…

Q: A difference between bacterial and eukaryotic translation is Multiple Choice translation can begin…

A: A difference between bacterial and eukaryotic translation is A. translation can begin on an mRNA…

Q: A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following…

A: The protein is synthesized from mRNA by the process of translation. It takes place in cytoplasm of…

Q: nonsense mutations add a stop codon, which stops translation at the site of the mutation. This makes…

A: Mutation can be defined as a genetic change in the genetic material of an organism, which results in…

Q: What determines which base is to be added to an RNA strand during transcription? Base pairing…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: RNAi is produced when Question 26 options: a single-stranded DNA shares the…

A: RNA interference (also called “RNA-mediated interference”) is a mechanism for RNA-guided regulation…

Q: What are ribosomes composed of? tRNA & proteins mRNA & tRNA rRNA & proteins mRNA & proteins…

A: The ribosomes are composed of two subunits a smaller and a larger and the sizes of prokaryotic and…

Q: 3' -T ACATC T T G G C GAC GAC T-5' Mutated DNA Sequence #1: MRNA sequence? (Circle the change) Amino…

A: 1)DNA - 3'- TAC ACC TTG GCG ACG ACT-5' mRNA - 3'- AUG UAG AAC CGC TGC UGA-5' Amino acid sequence –…

Q: which one would be least likely to cause Liam’s disease? Group of answer choices A. Mutation 4 B.…

A: Promoter: Is short nucleotides sequences located at 5'end that aid in switching on and off of a…

Q: 2. DNA Sequence: TAC TCC GGC TCT CcC AGT TGA ACT Mutated Sequence: TAC ICI GGC TCT CCA AGT TGA ACT…

A: Let us first convert the 3' to 5' DNA sequence into 5' to 3' mRNA sequence and will then translate…

Q: Which letter in the image represents the end product and the process of translation

A: Answer: CENTRAL DOGMA : It is the process of replication , transcription and translation of DNA.…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: CATCTACAAATAGCACCTAATTGTG What is the MRNA What is the protein What is the phenotype

A: The process of synthesis of RNA with the help of template DNA is called transcription. In this…

Q: After translation a protein needs to be folded correctly in order to function properly: C) What…

A: Proteins are long chains of amino acids. There are 4 types of proteins based on their structure:…

Q: Which of the following is true only for eukaryotic gene expression? mRNA is synthesized in the…

A: Note: Since the identifiers for the options are not mentioned, the options are assumed to be in the…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration…

A: The translation is a process of conversion of RNA codon sequences into their respective amino acid…

Q: Which of the following best describes the central dogma of molecular biology? O A) MRNA is…

A: Introduction In molecular biology, a central dogma is an illustration showing the flow of genetic…

Q: 3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence…

A: The term mutation refers to the change of DNA sequence which occurs either due to errors in DNA…

Q: Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA…

A: In the formation of mRNA from DNA, base complementarity rules follow. A pairs to U and T pairs to A.…

Q: Which of the following statements describing riboswitches is false? Group of answer choices They are…

A: Riboswitches are the Regulatory elements used for gene regulation by regulatory RNA. From above…

Q: The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: Why siRNA phenomenon is utilized in cell biology? Because specific gene silencing leads to blocking…

A: short double-stranded RNA again about 21-25 bases, would silence the corresponding geneThe RNA…

Q: During the transcription of DNA to mRNA ___. RNA polymerase moves along the DNA (reads) in the 5’to…

A: The information present within the DNA sequence (genes) is transcribed into an RNA strand. It is…

Q: When he sell requires a production of the specific proteins what steps must occur

A: Answer: PROTEIN SYNTHESIS = These are the long chains of amino acids together formed in a long…

Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the usual…

Q: Given the following coding strand of DNA: 3' – TACCGAGTACTGACT – 5', the mRNA that will transcribed…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. The copy,…

Q: What would happen if a mutation in DNA changed codon 6 in the mRNA to GUA? ( one nucleotide…

A: Sickle cell anemia disorder is characterized by the distorted shape of red blood cells such that…

Q: What is the sequence of the mRNA transcript that will be produced from the following sequence of…

A: Transcription is the process of synthesis of RNA from DNA. RNA polymerase catalyzes this process by…

Q: Base substitutions in a gene exon might not result in a change in the gene product because…

A: More than one codon specifies a single amino acid. That is why the protein sequence might not get…

Q: A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase…

A: Mutation refers to sudden change in the genetic material and is heritable. It may be on chromosomal…

Q: Please put the following steps of eukaryotic protein synthesis in order from first (1) to last (4)…

A: The process of gene expression in the cell occurs via the mechanisms of Replication, Transcription,…

Q: Which molecules are required during Translation? Choose ALL that apply

A: Central dogma consists of replication, transcription and translation. Replication is the formation…

Q: does DNA encode the instructions to make us? Select all the true statements. Group of answer choices…

A: DNA is necessary for all living things, including plants. It plays a role in heredity, protein…

Q: Matching type Choices are in the picture 1. simultaneous and rapid process producing mRNA and…

A: DNA instructs everything in the cell and is expressed in the form of proteins coded by DNA itself.…

Q: Acetylation is the [Select) of acetyl groups ta ( Select ) Acetylation will ( Select ] the…

A: Demethylation is a chemical process that removes a methyl group. Methylation is a biochemical…

Q: Failure to add the 3’ polyA tail will result in which of the following? The prokaryotic mRNA cannot…

A: Post-transcriptional modification is the process by which certain changes are made in the newly…

Q: Which of the following changes may cause a gene product to not loose functión? Prevent or reduce…

A: Introns and exons are found in the mRNA transcripts and introns are removed via the RNA splicing…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: RNA transcription is a process where double-stranded DNA is transcribed into mRNA. This mRNA is…

Q: Of all of the different codons that exist, three of them ___. do not specifiy a particular amino…

A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

what are the chances two people heterozygous for achondroplasia could have a normal child?

alternate forms of a gene is called

which molecules are required for translation

Expert Solution

Step 1

Achondroplasia is a genetic disorder having autosomal dominant pattern of inheritance.

Step by step

Solved in 2 steps

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A couple has had a child born with neurofibromatosis. They come to your genetic counseling office for help. After taking an extensive family history, you determine that there is no history of this disease on either side of the family. The couple wants to have another child and wants to be advised about the risks of that child having neurofibromatosis. What advice do you give them?
How to show respect, concern and love to a person with chromosomal disorders? What is the purpose of showing respect, concern and love to a person with chromosomal disorders?
List the important ideas in the video regarding genetic epistasis. https://youtu.be/0HfkCppZLfo
Why is folic acid important during pregnancy
what does a "lactation" concept map look like with 10 words or phrases?
Why doesn’t the father (II-1) have the disease breast cancer? What is the formal name for an individual having the gene but not showing the trait?
A 20-year-old patient is currently 10 weeks pregnant. She had a miscarriage at 13 weeks 1 year ago. What is her GPTPAL? G1P0 (0-0-0-0) G2P0 (1-0-0-0) GIP0 (0-0-1-0) G2P0 (0-0-1-0)
What is Down's syndrome? Give its symptoms and cause. Why is it that the chances of having a child with Down's syndrome increases if the age of the mother exceeds forty years?
Amniocentesis is a prenatal medical procedure conducted by extracting and analyzing fetal cells in the amniotic fluid, the fluid that surrounds the fetus. What information can be obtained about the developing fetus through amniocentesis? fetal infections environmental toxin-induced defects structural defects chromosomal abnormalities Incorrect
Which three factors are crucial in the diagnosis of genetic defects in the fetal stage? What do you think weighs the most?
If both parents carry one copy each of the mutation that causes Huntingtons , what are the odds that their child would have the disease ? A)25 B 75 C 50 D 100
A woman who is eight (8) weeks pregnant requests a direct test for Huntington’s disease on her fetus. She tells her geneticist that she wants the test because she recently discovered that there is a family history of the disease in her husband’s family. One of his parents is affected so he is at 50% risk of developing the condition. She is adamant that she does not want to give birth to a baby who is at risk of developing Huntington’s and says that the test will help her to ensure that this is not the case. In counseling, she reveals that she has discussed this issue several times with her husband but he has always said he is not willing to take a test. He does not want to know his status and is extremely anxious about the possibility that he might develop the condition. The woman and her husband are currently separated but are seeing a relationship counselor and trying to work things out. Despite this, the woman says they tend to fight a lot. When it is explained to her in counseling…