You are searching the sequence of a coding strand of DNA. What kinds of sequences would help you find the beginning of a protein-coding gene? Group of answer choices a promoter sequence upstream (to the 5' end) of a transcription start site and an ATG sequence corresponding to the start codon a transcription termination sequence a silencer sequence an ATA sequence corresponding to the codon for isoleucine
Q: Which of the following is NOT an event associated with translation termination? A stop codon…
A: Hi, Thanks For Your Question. Answer : Correct Option Is A terminal amino acid is added to the…
Q: Shown below is the genomic structure of the human B-globin gene. The numbers within the boxes…
A: Transcription is the process by which DNA act as template for the formation of mRNA . This process…
Q: Genetic expression involves transcription and translation. Match the structure or molecule to the…
A: Nucleic acids are a type of macromolecules present in the cell.
Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…
A: RNA polymerase extend or polymerise RNA. Sigma subunit of RNA polymerase binds to promoter…
Q: After transcription, how is mRNA processed in eukaryotes? (Choose all that apply) 3' polyA tail is…
A: TRANSCRIPTION It is the formation of mRNA from DNA. The mRNA formed has to undergo various…
Q: Only one of the two strands of DNA is transcribed because a. RNA polymerase binds to the…
A: Introduction : DNA or deoxyribonucleic acid is the genetic material present in all living organisms.…
Q: The coding sequence for gene F is read from left to right on the accompanying figure. The coding…
A: DNA is the polymer of nucleotides.
Q: The chain elongation in transcription continues until a termination sequence is encountered a stop…
A: In transcription , a special sequence contains U rich sequence downstream from a stretch of…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: Because of the remarkable efficiency with which DNA molecules are introduced into cells, E. coli is…
Q: A. RNA polymerase binds to a gene’s promoter. B. RNA polymerase moves over the gene and unzips the…
A: transcription is the process in which m RNA is formed as directed by the template strand of DNA.
Q: This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a…
A: The DNA is transcript into mRNA by the process of RNA transcription with the help of RNA polymerase…
Q: Introns are intervening sequences; what are exons?
A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…
Q: Which of the following correctly states a similarity between transcription in prokaryotes and…
A: Transcription is a process of synthesizing a messenger ribonucleic acid [m-RNA] from the…
Q: Which of the following statements regarding transcription is true? Helicase unwinds the DNA helix to…
A: Each nucleotide comprises three elements in a nucleic acid. One such component is a five-carbon…
Q: which of the following causes transcription to end? RNA polymerase reaches the terminator RNA…
A: Many processes occur within the cell for its normal functioning. They include replication,…
Q: What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription…
A: Elongation Factor Thermo Unstable (EF-Tu) is one of the most prevalent proteins in bacteria, making…
Q: Listed below are steps in the transcription process. Reorganize the list so the steps in the…
A: Correct steps of Transcription are as follows. 1. General Transcription factors bind TATA box…
Q: The diagram below depicts an active transcription bubble after a short period of RNA synthesis…
A: Transcription involves the copying of information from a strand of DNA into a new molecule of…
Q: Transcribe the following DNA molecule into mRNA. Make sure to find the start codon to begin your…
A: A start codon initiates the transcription while stop codon terminates the transcription process.
Q: A codon is a triplet of bases which codes for an amino acid. Exons are intervening sequence that are…
A: These are true or false statements. Explanations are given as well.
Q: Sometimes errors occur during transcription or translation. each amino acid is coded for by several…
A: This suggests that the genetic code is degenerate which means that each codon is specific for only…
Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…
A: Let's rearrange the mRNA in the codes of three. ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…
Q: In picture a (look at picture) a tRNA is already bound to the initiator codon at the start of the…
A: Translation is the process of synthesis of polypeptides (protein) by combining monomers units…
Q: Which of the following causes transcription termination in bacteria? RNA polymerase runs out…
A: In bacteria, there are two types of RNA transcription, a rho-factor dependent termination and…
Q: The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base…
A: Genetic codes are triplet, ambiguous, degenerate and non-overlapping. Three bases codes for an amino…
Q: Choose all of the following that you think are correct Protein(s) that play a role in initiating…
A:
Q: This diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the…
A: Transcription is the process of formation of mRNA using DNA as template. This is possible with the…
Q: What are the specific steps of eukaryotic transcription? Be sure in your discussion that you include…
A: Transcription is the process which consist of several steps of DNA based gene expression.Here a…
Q: All of the following EXCEPT which one occurs between transcription and translation. -Introns are…
A: Transcription is a process of coping down information from DNA to RNA. Translation is a process…
Q: Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is…
A: Given: Sequence of template DNA is…
Q: If you were to hybridize a eukaryotic gene to its corresponding mRNA, the two molecules would not…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: man rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop…
A: The rho factor provides directions for creating a macromolecule referred to as rhodopsin. This…
Q: Which of the following components is involved in the initiation of transcription? Group of answer…
A: Reply and Explanation: 1 Record begins when a record factor ties to the advertiser alongside a RNA…
Q: Below is a segment found in the DNA template strand of a gene for a structural protein. This section…
A: The abrupt changes in DNA sequence of nucleotides is called mutation. It may or may not change the…
Q: Which of the following statements is true about transcription & translation? O a. In prokaryotes,…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: This sequence given is of one strand of eukaryotic DNA containing a hypothetical gene. The base that…
A: Answer : DNA---> mRNA ----------> PROTIENS (AMINO ACIDS) A=T, G=C(DNA), A = U(mRNA) From…
Q: This is a list of molecular changes that could happen during DNA replication, transcription, mRNA…
A: The mutation alters allele frequencies by constantly introducing new alleles, which can be…
Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……
A: Bacterial transcription is the process in which a segment of bacterial DNA is copied into a newly…
Q: The figure shows a Venn Diagram with four areas, Area A- Terms that only apply to eukaryotic…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: How can one primary transcript result in several polypeptides with different amino acid sequences.…
A: Primary transcript is called as Heterogeneous nuclear RNA or hnRNA. It has Introns and Exons. Exons…
Q: The sigma factor protein's role in transcription in E. coli includes which of the following?…
A: Sigma factors are subunits of RNA polymerase in bacteria. They control synthesis of RNA intitiation.…
Q: In this picture, a tRNA is already bound to the initiator codon at the start of the mRNA strand. The…
A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…
Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18…
A: Transcription is the process of creating new RNA by duplicating the DNA strand. Transcription is the…
Q: Based on the electron micrograph shown, which of the following statements is/are correct/true?…
A: Introduction :- Microorganisms, cells, big molecules, biopsy samples, metals, and crystals are among…
Q: The figure shows a Venn Diagram with four areas, Area A- Terms that only apply to eukaryotic…
A: The proteins are synthesized with the correct amino acid sequence based on instruction in DNA. This…
Q: Which of the following statements is true about transcription & translation? O a Ineukaryotes,…
A: According to the Central Dogma of Molecular Biology, DNA generates RNA, which in turn generates…
Q: For each of these things, say whether it describes the coding sequence or the regulatory sequence.…
A: Coding sequences are sequences or portions of a gene or mRNA which codes for a protein. The coding…
Q: The human rhodopsin gene is 2675 nucleotides long from transcription start site to transcription…
A: Throughout an organism's life, the original DNA (deoxyribonucleic acid) molecule in the nucleus acts…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?
- The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
- he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
- Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5'-GGCCCUUUUACCCGGUUUU-3' 5'-GCAUCUUACUGAUGCUUUU-3' a stem-loop hairpin structure followed by a sequence of uracil residues in the RNA a palindromic region followed by a sequence of adenine residues in the RNA a sequence of uracil-adenine RNA-DNA base pairsThe sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.