Which category of RNA carries amino acids for the process of translation? rRNA snRNA mRNA tRNA
Q: The role of Zn2+ in catalysis is usually to: a. Stabilize a (-) charge in the transition state Ob.…
A: Proteins include zinc, which is either essential for preserving protein stability and structure or…
Q: Name the nitrogen base component of DNA shown here. (Hint: Name of the particular nitrogen base not…
A: 1. Name the nitrogenous base component of DNA shown here- The given structure is guanine. It is…
Q: 4. Histidine, one of the 20 amino acids, contains an imidazole functional group with a pKa of 6.0.…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: What distinguishes metalloproteins from glycoproteins in particular?
A: Some proteins contain one or more chemical groups(other than amino acids) covalently linked to them.…
Q: Consider the following reaction. CH₂-CH-COO-CH₂-C-Coo- он b Which group of enzymes catalyzes this…
A: The six functional classes of enzymes are hydrolases, oxidoreductases, lyases, transferases, ligases…
Q: Posttranslational modifications of proteins do not include: peptide bond formation glycosylation…
A: Proteins are one of the essential biomolecules for life. These are formed by translation from the…
Q: 1) What are the names of the sites of the enzymes labelled with A and B? (15%) 2) Mutation of Ser195…
A: Chymotrypsin is a serine protease. It catalyses the hydrolytic cleavage of the peptide bond next to…
Q: cyclophosmamide
A:
Q: The entire set of chemical reactions occurring in a living system is referred to as: O a..…
A: The regulation of metabolism involves the processes by which metabolic pathways (both the anabolic…
Q: Which of the following is incorrect? a. Without an enzyme, reaction rate can be increased by…
A: Enzymes are the catalysts of biochemical reactions that increase the rate of reaction. Enzymes have…
Q: Determine the type of biochemical reaction that occurs in the reaction shown below. O redox…
A: In the given question, a cyclic pyranose structure is given. It is a pyranose because it has 6…
Q: Video resource: Biochemistry of carbohydrates by Armando Hasudungan
A: Carbohydrates are organic molecules arranged in form of aldehyde or ketones with multiple…
Q: A student attempted the quantitative analysis of skim milk proteins as described in practical…
A: Beer Lamberts law is the governing principle which allows us to determine the concentration of a…
Q: Which of the following is incorrect about the competitive inhibitors? a. They increase the affinity…
A: Competitive inhibitors are the substances that Inhibit the enzyme activity by competing with the…
Q: Hypertrophic cardiomyopathy is caused by mutations in the β-myosin heavy chain gene. One common…
A: Codons are triplets of nucleotides that codes for an amino acid. The ribosome read the codons in a…
Q: You are the CEO of a drug company where you've asked five teams of scientists to generate new drugs…
A: Blood pressure is the force that circulating blood exerts on the walls of arteries. Blood pressure…
Q: Question 2 HER2 and HER3 belong to a family of receptor tyrosine kinases (RTKS). A representative…
A: The Human Epidermal Growth Factor Receptor (HER) or simply Epidermal Growth Factor Receptor (EGFR)…
Q: In urea assay (Catalog #K375-100) what is the nmol (range) it can detect?
A: Urea assay (catalogue #K375-100) is a colorimetric assay used to quantify the urea in any given…
Q: You obtained the following raw data when setting up a Biuret standard curve: BSA (mg/ml) 0 1 2 3 4 5…
A: Biuret test is a quantitative method to determine the total protein concentration in any unknown…
Q: in oder to accelerate chemical reactions enzymes have evolved 1) High affinity towards the product…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. As a result of increased…
Q: The reaction catalyzed by malate dehydrogenase has a ΔG°′ value of +29.7 kJ⋅mol−1. Given what this…
A: Free energy changes in biochemical reactions are denoted by ΔG°', the biochemical standard…
Q: C. The dissociation constant, (Kdisso) for the ES complex
A: Option c is the answer
Q: At neutral pH (pH = 7): a. acidic amino acids have a net positive charge b. basic amino acids…
A: Net charge of an amino acid is determined based on the PH of the medium and pKa of the amino group,…
Q: I have a fill in the blank question. "1) Heterophobic or Homotrophic effects= are changes in…
A: The phenomenon of Allostery describes the change in the affinity of binding to a ligand or substrate…
Q: Starting as a lipid in some holiday prime rib, trace the path that energy and biomass make as that…
A: It is well known to us all that both mass and energy are conserved in the universe. Hence all mass…
Q: Hello, I am trying to understand how to calculate the overall charge of a peptide at pH = 7. Please…
A: Peptides are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: Which of the following interactions are due to the complementarity of the molecules: various…
A: Complementarity refers to the physical aspects or shape of macromolecules that fit one another in…
Q: Explain how would compounds such as NAD+, NADH, ubiquinone, ubiquinol and cytochrome are able to…
A: Electron carriers feed the electron to Electron Transport Chain (ETC). This component of aerobic…
Q: You are saying that the inhibitor is competitive inhibitor. But according to data Vmax for reaction…
A: Enzyme kinetics can be calculated more accurate by using lb plot which can be constructed by…
Q: Which of the following is incorrect about the rate of an enzyme-catalyzed reaction? O a. It does not…
A: The rate of an enzyme-catalyzed reaction depends on certain factors and one of them is concentration…
Q: Q27 Please solve all u can
A: Enzymes catalyse biochemical reactions and lower the activation energy. Enzyme kinetics include km…
Q: an enzyme acts on a substrate X. The enzyme exists in four different forms, with different catalytic…
A: Enzymes are proteins that can act as biocatalysts. Substrates bind to the active site of the enzyme,…
Q: Which of the following statements best describes the absorption of glucose? Absorption of…
A: Glucose absorption is the process of uptake of glucose by the cells of the body. Glucose is the…
Q: 4. the first two reactions in glycolysis associated with unfavorable AG° values, i.e., AGº > 0, both…
A: Glycolysis is a process where glucose is broken down to pyruvate to yield energy. The energy formed…
Q: Another question about tecniques that im getting confused over Can someone explain me which one…
A: Trypsin and chymotrypsin are protease enzymes that cleave the internal peptide bonds in a peptide.…
Q: Integral membrane proteins can exist as all of the following, except: a. A single helix Ob. A beta…
A: Integral membrane proteins contains both hydrophilic and hydrophobic domains. The hydrophobic domain…
Q: Sphingolipids serve what function in biological systems? A) energy storage B) cell membrane…
A: Sphingolipids belong to a different category of lipids. Sphingosine, 18-carbon amino alcohol,…
Q: Consider, for example, that a particular serine residue is phosphorylated to activate the protein.…
A: Phosphorylation can either activate or deactivate a protein. Phosphomimetics replaces amino acids in…
Q: Which of the following is incorrect? Oa. None; all the other choices are correct O b. Disulfide…
A: Disulfide bonds are the bonds that are formed between two sulfhydryl groups. It is a covalent bond…
Q: Q47 (1.5): Which kind of surfactant type of cholinephospholipid? it has cation NH3+ and anion PO4-…
A: Phospholipids are classified as glycerophospholipids and sphingophospholipids based on the type of…
Q: Q38 (1.5): In the diagram, what does the plane draw behind the peptide bond indicate? Ca N H H R
A: A polypeptide is a long chain of amino acids linked via peptide bonds. A peptide bond is the bond…
Q: Lipids are common components of membranes and cell walls. What is the structural motif of membranes?…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: Please explain how the electron transport chain works with respect to FADH2. Please include the…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate…
Q: A (-) charge in the transition state can be stabilized by a catalyst, which is usually a(n): a.…
A: A negative charge in the transition state can be stabilized by a BASE. Incorrect options- a. anion…
Q: Complete the interrelated pathways by providing the neccesary metabolite, enzyme, reaction or…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: Please fully explain (use illustrate where appropriate) the Modes of Enzyme Catalysis exemplified by…
A: Chymotrypsin is a protease enzyme that cleaves the proteins at the C-terminal end of phenylalanine,…
Q: n Multi-Column Purification of rGFP. What happens to the protein amount, protein purity, and/or…
A: Protein purification is a series of steps or processes that are intended to isolate one or a few…
Q: Which of the following is incorrect about the transition state analogs? O a. They are synthetic…
A: Transition state analogs or analogues, are chemical compounds with a structure resembling the…
Q: All of the following are mechanisms for regulating enzyme activity in the cell, except: a. Rate of…
A: Enzymes catalyses a reaction, they remain unchanged after the completion of reaction. They just…
Q: A B Amino Acid Lysine Abbreviation 3- Letters Lys 1- Letter K pk₁ -COOH 2.18 pK₂ -NHS* 8.95 PKR R…
A: Amino acids are biomolecules where an alpha carbon is bonded to an amine group , a carboxylic group,…
Step by step
Solved in 3 steps
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA template strand. (Remember that mRNA has uracil instead of thymine.) Template Strand: GCUAUGUUUExplain why the translation of a given mRNA can be inhibited by a segment of its complementary sequence, a so-called antisense RNA.
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’Define transfer RNA (tRNA)
- If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequenceThe flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…
- Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptideGive the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCTAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position C UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu his ССС pro ССА CỤC САС CGC arg CỦA САА CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asn ser AUC ile ACC thr АCА AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GUC GCC ala GCA GẠC GGC val gly GUA GAA GGA glu GUG GCG GAG GGG glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg) Third position (3'-end) AGUCAG First position (5'-end)