3.What could mutation m1 do to the rate of transcription? Increase? Decrease? Have no effect? decrease 4.What would mutation m2 do to the length of the primary RNA transcript for this gene? Increase? Decrease? Have no effect? have no effect 5.What would mutation m2 do to the length of the mRNA transcript for this gene? Increase? Decrease? Have no effect? increase 6.What would mutation m3 do to the length of the primary RNA transcript for this gene? Increase? Decrease? Have no effect? have no effect 7.What could mutation m3 do to the function of this protein? Change it? Have no effect? change it 8.What effect would mutation m4 have on the degradation rate of the MRNA transcript? Increase it? Decrease it? Have no effect? decrease

True or False

4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).

4. This is the same gene as #1, but with a mutation!! (C/G-T/A at base pair 33) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now What type of mutation is this? C. 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATTATTACATTGACTAACG -3' 5 1 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAATAATGTAACTGATTGC -5' C. 1 -+ --+-- --+-- 5. This is the same gene as #1, but with a mutation!! (insertion of CG at base pair 29) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now What type of mutation is this? --+-- -+-- 51- CAAATTAATGGEGGO 5'- CAAATTAATGGCGGCATTTACGATGGTGCGGGATCATTACATTGACTAACG -3' 5 -+-- 1 -+- 3'- GTTTAATTACCGCCG 3'- GTTTAATTACCGCCGTAAATGCTACCACGCCCTAGTAATGTAACTGATTGC -5' -+-