Using the codon wheel below, identify which of the following mutations of the DNA sequence TTT TAC ACT would potentially have the least effect on the protein containing the sequence?
Q: The sequence below represents a strand of mRNA. Draw a box around the start codon. Then use the…
A: Introduction: sequence of the three nucleotides which together form a unit of the genetic code…
Q: Love the One You're With There are six known species of lizard that can reproduce both sexually and…
A: The organism's or an environmental group's atmosphere is the combination of physical, biological,…
Q: How would placing a plant in complete darkness affect the Calvin cycle? A It would inhibit the…
A: Introduction : Plants, algae, and some microorganisms utilize the process of photosynthesis to…
Q: talk about darwins journey in Falkland island, don't forget to talk about the tools that he used if…
A: Sir Charles Robert Darwin formulated the Theory of Evolution by Natural Selection, based on his…
Q: Find the events from prokaryotic translation from the list below and list them below in order, by…
A: Answer : the events from prokaryotic translation are : G - small ribosomal subunit binds mRNA…
Q: Which RNA strand would be produced during transcription of a gene that has a CODING STRAND sequence…
A: Transcription is referred to the process by which DNA is converted into its RNA equivalent. In the…
Q: GROWTH OF FUSOBACTERIUM ON KANAMYCIN/VANCOMYCIN AGAR (KV) CAN BE DESCRIBED AS a) pigmented b)…
A: Anaerobic gram-negative bacterium called Fusobacterium is frequently responsible for the emergence…
Q: Introduction: Body Mass Index is the official name of BMI. It is a measurement technique that…
A: The exome has historically been described as the sequence in the genome that includes all exons of…
Q: mitochondrial genes affecting tRNAs. For example, one form of MELAS (mitochondrial myopathy,…
A: Mitochondrial diseases ( MELAS) are a heterogeneous group of rare genetic disease it is caused…
Q: . BMI (Body mass index) is the ratio mass in kilograms to the square of height in kilograms Between…
A: Introduction : Body Mass Index is the official name of BMI. It is a measurement technique that…
Q: What is it called when some nutrients can not be adequately measured to create an RDA or EAR value?
A: Dietary reference intake consists of 4 reference values based on nutrition according to their…
Q: Intracellular signaling pathways provide multiple opportunities for the amplification of a response…
A: there are several intracellular signaling pathways works together in a body that regulates normal…
Q: 1. Explain the basic steps of a simple reflex arc like a stretch reflex. 2. Describe one…
A: Introduction:- A reflex is an automatic response which does not involve the consciousness of…
Q: What are the formulating ingredients used in nicotine chewing gum? Please answer at your own easy…
A: Nicotine chewing gum is used for the cessation of smoking habit. It helps to decrease the withdrawal…
Q: What is the new DNA sequence and the corresponding new amino acid sequence of these two mutations?…
A: Mutation is any change in the DNA sequence. These are of different types for example, missense…
Q: DNA is pretty important because it is instructs what proteins to make. the energy producer in a…
A: Introduction DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in…
Q: Which of the following is NOT required for a protein, like hemoglobin, to show positive…
A: CO2 is a regulator of hemoglobin. It binds to specific sites on the hemoglobin molecule, changing…
Q: Climate change is becoming an ever-growing threat to human health and biology. Research an incident…
A: Introduction Long term pattern of weather in a region is called climate. Air temperature and…
Q: 19. Fish with Hb-1 likely occur in warmer waters than fish with Hb-2. True O False
A: Introduction : In low temperatures with typical environmental conditions, fish with the Hb-2…
Q: Why does the endospore retain the green stain, while the ordinary cells do not?
A: It allows the bacterium to produce a dormant and highly resistant cell to preserve the cell's…
Q: (a). Four of these energy-rich molecules are produced in glycolysis: (b). Glucose is split into two…
A: Introduction In order to get chemical energy for cellular processes, organisms require oxygen to…
Q: 1) Narrow sense heritability of withers height in a population of quarter horses is 17%. The average…
A: The narrow sense heritability of the hand's height of a horse population was given at 17%. The…
Q: Explain the entire process of DNA replication.
A: Introduction : The biological process of producing two identical copies of DNA from a single…
Q: The following is a picture of Eosin Methylene Blue Agar. What does the growth on this plate…
A: INTRODUCTION Eosine methylene blue agar Used for the isolation of gram negative bacteria Toxic…
Q: Match the following diseases to their cause Q-Fever Psittacosis Pneumocystis Coccidiodes Blastomyces…
A: Introduction : An infectious disease is a condition that develops as a result of a pathogenic…
Q: What characteristics in a human pedigree suggest a mitochondrial location for a mutation affecting…
A: A human pedigree includes the family history of an individual, listing the parents, grandparents,…
Q: efine hormone. Name the hormone secreted by thyroid gland. Write its function. Why is it advised to…
A: In the body, hormones act as messengers. Endocrine glands release these substances. In order to keep…
Q: 23. If a fly acclimated more slowly than the change in air temperature, it would pay an opportunity…
A: Adaptation is needed for living organisms to survive. An adaptation is a characteristic that allows…
Q: Membrane proteins have six possible functions (transport, cell-cell adhesion, sensing signals,…
A: Introduction-Synaptic Transmission- The synapse is the "space" between neurons or neurons and other…
Q: Red-green color blindness is an X-linked recessive disorder. If Allison is heterozygous (a carrier),…
A: The X-linked genes show a different pattern of inheritance in males and females. The male progeny…
Q: Q4.14. Recall that in the big Yellowstone fires, lodgepole pine burned and then grew back within…
A: Introduction: Lodgepole pine (Pinus contorta var. latifolia) forests is the highly resilient to…
Q: How does the means of gas exchange differ by the relative age (evolutionarily) of each group?
A: Gas exchange is the process through which oxygen and carbon dioxide are exchanged between the air…
Q: Provide a explantion and diagram of the Intracellular mechanism of smooth muscle relaxation via…
A: Introduction: Our body have different kinds of nervous system such as central nervous system…
Q: Describe the formation of chromosomes
A: Answer: Chromosomes : It is the long thread like structure of proteins and a single molecule of DNA…
Q: 10.0 8.0 6.0 5.0 4.0 3.0 2.0 1.5 1.0 0.5 MC 179 196 198 210 222 234 253 254 M נות
A: To pinpoint a specific gene's location on a chromosome, geneticists employ maps. In one kind of map,…
Q: 1) A forensic scientist is required to collect blood samples from the crime scene and analyze it to…
A: A forensic scientist is a scientist who uses scientific principles and techniques to investigate…
Q: Which best describes the mode of inheritance of the afflicting allele in the following pedigree?
A: The branch of biology that deals with the study of genes, heredity and genetic variations and…
Q: Based on the knowledge acquired about the conservation and propagation of microorganisms, propose…
A: Yeast is a eukaryotic organism that belongs to the fungus kingdom. It is single-celled and is used…
Q: Why do many tumors metastasize (e.g. what advantage does it give them) and why can metastatic…
A: Metastasis is a complex process that is not fully understood. However, it is clear that the ability…
Q: 1. In general, why do you think GWAS is useful? What kinds of problems could GWAS be used to solve?
A: The branch of Biological Sciences that deals with the study of genome is known as Genomics. The…
Q: II. Questions for Research. 1. What are the adult derivatives of the pharyngeal pouches? 2. What is…
A: A research question is a question that a researcher asks in order to collect data that will help…
Q: Compare and contrast the different experiments of Redi,Needham,Spallanzani and Pasteur on the origin…
A: Origin of life has many theories with various interpretation. Each and every theory differs from one…
Q: a man who is not bald married a non bald female whose mother is bald. what is the chance the couple…
A: Baldness and hair loss are most common on the top and front of the head. Thinning frequently begins…
Q: When doing an ELISA you need Group of answer choices A) to do negative control on the first strip of…
A: INTRODUCTION ELISA : Enzyme linked Immunosorbent Assay
Q: Fill up the table: Test tube A ISO amy B ethanol C methanol D ethanol Observations Before (include…
A: Fischer esterification, an acid-catalyzed reaction between isoamyl alcohol and glacial acetic acid,…
Q: Determine the process by which the small RNA species identified by CDNA sequencing is considered as…
A: Transcriptome sequencing is used to identify the regulating small ribonucleic acids (SRNAs)…
Q: What abiotic and biotic consequences has fragmentation from different land-use practices had on…
A: Together with its humid-subtropical climate, Louisiana's physical geography forms the basis for a…
Q: Describe the key features and limitations of common diagnostic tools. List four (4) features and…
A: Molecular diagnostics is a set of procedures that uses molecular biology to assess biological…
Q: 4. Identify and explain the type of natural selection (directional, disruptive, stabilizing) that…
A: Biological evolution is aprocess of descent with modification. Lineages of organisms change through…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
- During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, IIFrom this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminusVal (V) Ala (A) Arg (R) Ser (S) Lys (K) Start Stop Using the codon wheel below, identify which of the following mutations of the DNA sequence TTT TAC ACT would potentially have the least effect on the protein containing the sequence? Asp (D) G A JOOGA C Asn (N) اندان A داد Glu (E) 9/2/3. 20402 CAGUCAGUCAGUC GU ט|כ Thr C U G G A Gly A A Phe (F) C/U/G ●Met (M) Leu (L) GU AC C CUGA GACUGA ACUGACUG A Arg (R) G כט Ser (S) C U с Gin (Q) A G U C A G બનીનો His (H) Tyr (Y) U G C Cys (C) Pro (P) Trp (W) Leu (L) A) TTA TAC ACT B) TTT TTC TCT C) TTT TAC TGA D) TAA AAC AGA E) They would all have the same effect.
- 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd GFrom this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH|
- On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.