**Instructions for mRNA Translation Exercise** The sequence below represents a strand of mRNA. Follow the steps outlined: 1. **Identify the Start Codon:** Draw a box around the start codon in the sequence. 2. **Translate the mRNA Sequence:** Using the provided codon table, translate the mRNA strand into the corresponding amino acids. Note that the start codon also codes for an amino acid. 3. **Find the Stop Codon:** Stop translating at the stop codon. There is a stop codon present in the sequence. If you do not find it, you may have missed an important detail. *Sequence:* ``` U A U G C A U G G U U U A A U C ``` Please ensure accuracy in transcription and translation for effective learning.

Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutation

Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.

A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid chain are given below: mRNA segment:  GCC UAC AAU GCG Amino acid chain:  Ala-Tyr-Asn-Ala Knowing that insertion mutations shift the triplets by one base, if an insertion mutation adds a U to the beginning of that mRNA segment, what will be the new triplet/codon grouping and the new amino acid chain?  Group of answer choices a. U GCC UAC AAU GCG; Ala-Tyr-Asn-Ala b. UCC UAC AAU GCG; Ser-Leu-Gln-Cys c. UGC CUA CAA UGC G; Cys-Leu-Gln-Cys d. UGC CUA CAA UGC G; Ala-Tyr-Asn-Ala e. UGCC UAC AAU GCG; Cys-Tyr-Asn-Ala

Below is an MRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz are numbered as shown. Answer questions 1-4 for the mRNA of Lstqz. A codon table with amino acids shown in single-letter code has been provided at this link. 1 5 10 15 20 25 30 35 40 5' AGAGAUGGCUCCUUCACGCUUUACCUACUGAGUAGGGCUAAG 3’ Which nucleotide number corresponds to the first nucleotide of the stop codon? (Please answer as a numeric value) 30 Write down the first five amino acids generated from this mRNA in single-letter designation with no spaces. Example: if the answer is (from N to C terminus) Histidine-Threonine-Glutamate, you would put in HTE (uppercase) as the answer.

If a codon GCA codes for the amino acid alanine in a prokaryote, what will it code for in a eukaryote? _____

A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA ATG CCT TGT GẠC ATG CCT TGA GẠC transcription transcription MRNA MRNA AUG CCU UGU GAC AUG CCU UGA GAC original sequence mutated sequence What kind of mutation will result from the mistake made during DNA replication in the nucleotide sequence above? O A. Silent Mutation B. Chromo C. Nonsense Mutation D. Frameshift Mutation

If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA code? Recall that DNA does not use "U" as a base. Enter your answer below using the same format as shown here (three capital letters for each codon, separated by a single dash, no spaces, repeat for each codon). Table 26-1 The Genetic Code First Third Position Position (5'-end) Second Position (3'-end) U C A G Phe UAU UCU UCC Тyr Тyr Stop Stop UGU UGC Cys Cys Stop Trp UUU Ser U UUC Phe Ser UAC C UUA Leu UCA Ser UAA UGA A UUG Leu UCG Ser UAG UGG G Leu Leu Leu Leu CAU САС CAA CAG CUU CCU Pro Pro Pro Pro His His CGU Arg Arg Arg Arg U CỤC CỦA CUG CCC CCA CGC CGA C Gln Gln CCG CGG G Пе Thr ACU АСС ACA ACG AUU AAU Asn AGU Ser U AAC AAA AAG AUC Пе Thr Asn AGC Ser C AUA Ile Thr Lys Lys AGA AGG Arg Arg A A AUG* Met Thr GUU Val Val Val Val GCU GCC GCA GCG Ala GGU GGC GGA Gly Gly Gly Gly U C A GAU GỤC GUA GUG Asp Asp Glu Glu Ala GAC G Ala Ala GAA GAG GGG *AUG also serves as the principal initiation…

What is the best option?

Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid A  T  G     A  T  C       This would be an example of which type of a point mutation?__________________________