4. Identify and explain the type of natural selection (directional, disruptive, stabilizing) that accounts for the evolution of the hollow bones of birds, which make flight possible
Q: What is the role of NAD+ and FAD in the breakdown of glucose?
A: INTRODUCTION Glucose Glucose is a simple sugar molecule that act the main source of energy in our…
Q: 4a) Which of the following is true about infants’ visual acuity? Select one: i. Poor visual…
A: Proper child development is very important in a person's life. From infancy until early adulthood,…
Q: Many cells face serious difficulty living in a hypotonic environment and adapt in various ways to…
A: Turgor pressure is the hydrostatic pressure that can accumulate in living, walled cells when it…
Q: My Planet is called _____________________. It is located in the ___________________. The weather is…
A: Astrobiology It is the study of life in the universe. Understanding life and the nature of the…
Q: What conclusions are there about how glucose is oxidized based on what is learned about the cellular…
A: A glucose molecule gradually decomposes into carbon dioxide and water during cellular respiration.…
Q: The Multiregionalism model of modern human origins hypothesizes that____. a. some features of…
A: The evolution of humans is based on different hypotheses. There are two hypotheses which are more…
Q: Read This! When phospholipids are added to an aqueous environment (consisting mostly of water) the…
A: Introduction Cells are box or chamber-like structures containing fluid cytoplasm enclosed by…
Q: In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand…
A: Introduction : The genetic material in most organisms is DNA or Deoxyribonucleic acid. The…
Q: When making bread with common yeast, the reaction starts as an aerobic process and then becomes an…
A: The bubbles obtained in the bread is the result of the formation and collection of gases such as…
Q: a) Viruses can have DNA or RNA genes b) Antibiotics can kill bacteria, viruses and fungi c)…
A: INTRODUCTION Answers of a to l is given below.
Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…
A: True breed plants are defined as having identical alleles, which constitute their genotype and give…
Q: Why should it make sense that a mitochondrion(a cellular organelle) is larger than a phospholipid…
A: Mitochondria (singular: mitochondrion) is the cell organelle that involves production of energy in…
Q: mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B.…
A: In eukaryotic cells, the primary transcript undergoes post transcriptional modification to form a…
Q: QUESTION 6 The agouti gene in mice plays a role in determining coat colour. At this locus (a term…
A: The dominant recessive nature of two or more alleles of a gene decides the phenotypes. The genotypes…
Q: What does the antisaccade task measure? A. The ability to inhibit a movement B. The ability to vary…
A: The cerebral cortex is the uppermost part of the brain and contains the majority of the brain's grey…
Q: (a). Four of these energy-rich molecules are produced in glycolysis: (b). Glucose is split into two…
A: Introduction In order to get chemical energy for cellular processes, organisms require oxygen to…
Q: The following DNA sequence is found on a chromosome in rice plants: 5’…
A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…
Q: A human STR locus contains a tandem repeat (TAGA), where n may be any number between 5 and 15. How…
A: Introduction The traits of a living organism are determined by its genotype. These traits are…
Q: 41) Dideoxyribonucleotides (ddNTPs) are unusual in both the 2' and 3' hydroxyl groups have been aced…
A: Normally dNTPs that is the deoxy nucleotide tri phosphate are inserted into the growing DNA chain by…
Q: Does a single fingerprint pattern run in your family? Why are fingerprints unique to every…
A: Fingerprints are the patterns that are left behind when an individual presses their finger onto a…
Q: estion 4 Dictyostelium discoideum is a slime mold used in research. In this species, individual…
A: Introduction : A species of soil-dwelling amoeba called Dictyostelium discoideum is a member of the…
Q: A 28-year-old woman has been sick with the flu for the past week, vomiting several times every day.…
A: Introduction : Normal blood pH level in humans ranges between 7.35 - 7.45 which is slightly basic.…
Q: When genes from two parents mix together to form the genes of their child, this is called a.…
A: A gene can be described as the basic unit of inheritance. A gene is transferred from one generation…
Q: What is the description of the growth and growth pattern of the microorganisms in the spread plate…
A: In the spread plate method, the growth of microorganisms is determined by the number of colonies…
Q: Assuming that the mean size of the human sau3AI partially digested fragments clones is 3kb,…
A: Human sau3AI is a tool used to help predict and diagnose disease. It is a blood test that looks for…
Q: A 30-year-old woman has had increasing tenderness and nodularity in both breasts over the past two…
A: Introduction A lower risk of breast cancer is closely correlated with the degree of age-related…
Q: What would be the f2?
A: Drosophila has been widely used in genetic studies as it produces a large number of offspring and…
Q: Gaucher disease is an early onset rare autosomal recessively inherited lysosomal storage disorder…
A: Given: Gaucher disease is an autosomal recessively inherited lysosomal storage disorder (LSD). An…
Q: 마이다 어마어마 마이다이어리이다 ㅁㅇㅁㅇ ㅇㅇㅁㅁㅇㅁㅇㅁㅇㅁㅇ 1) The following pedigree shows a pattern of inheritance of a…
A: The answer is maternal imprinting; male parent
Q: 72 Arthur Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his…
A: Here the boss is the DNA strand from which arthur and his co worker carol are formed. arthur and his…
Q: What is the significance of having a properly collected urine What is the drawback of routine…
A: Question : What is the significance of having a properly collected urine. Answer : Proper…
Q: Determine whether this statement is true or false: Aminoacyl-tRNA synthetase covalently links the…
A: Transfer RNA, often known by the acronym tRNA and formerly known as soluble RNA (sRNA), is an…
Q: With which kind of antibiotic (static or cidal) would you expect the MIC and MBC to be about the…
A: Introduction : MIC is the minimum inhibitory concentration of the antimicrobial agents to inhibit or…
Q: Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which…
A: DNA replication occurs prior to cell division and gets the cell ready for mitosis and meiosis.…
Q: Which is a structural gene? A. The gene that encodes ß-galactoside permease OB. Allolactose OC. The…
A: Operon is the gene regulatory mechanism in prokaryotes that regulates many genes that are involved…
Q: Does DNA alterations during DNA replication result in the formation of cancerous cells? And how does…
A: DNA is the deoxyribonucleic acid, which contains the genes in the form of a sequence of nucleotides,…
Q: 1. What are the new DNA sequences and the corresponding new amino acid sequences of these two…
A: Any change in the DNA sequence is known as mutation. Usually two types of mutations are found that…
Q: ← 32°F Mostly cloudy с app.101edu.co Question 18 of 25 What product(s) is (are) formed in a…
A: Transamination is a reaction in which an amino group is transferred to a ketoacid to form a new kind…
Q: Assumptions: . If the parent expresses the trait, they are homozygous dominant If the child/children…
A: In genetics, the genes forms the basic hereditary units of life. The genes has two alternate forms…
Q: each statement below indicate whether it is true or false. A. Assume that a species has a diploid…
A: These statements are simply from genetic and molecular biology. Aneuploid is simply change I'm…
Q: how does COVID previously perceive to impact healthcare organizations and/or the healthcare…
A: The development of the coronavirus illness, that is brought on by transmission with the previously…
Q: What characteristics in a human pedigree suggest a mitochondrial location for a mutation affecting…
A: A human pedigree includes the family history of an individual, listing the parents, grandparents,…
Q: THIS IS BABY's CORD BLOOD SAMPLE. The letters on the cell represent BABY's RBC antigens, those…
A: The ABO blood group system is used to denote the presence of one, both, or neither of the A and B…
Q: Using the Butterfly stroke in swimming as an example (see video); What is the significance of having…
A: Butterfly stroke It refers to a swimming stroke that is swum on the chest. In this stroke, both arms…
Q: 5. In a given population of diploid individuals, two alleles of gene A exist, A and a. Gene A DNA…
A: Introduction:- PCR ( Polymerase chain reaction) is a biophysical techniques which is used to amplify…
Q: An insulin-dependent diabetic patient calls the office complaining of sudden onset of nausea. Upon…
A: Diabetes type 1 is a chronic illness also referred to as juvenile diabetes or insulin-dependent…
Q: Below is a tulip flower. Based on your reading, click the structure or structures where pollen is…
A: A tulip is a flower with bright petals and is a herbaceous bulbiferous geophyte. It is a complete…
Q: The____ tool industry characterizes the Middle Paleolithic / Middle Stone Age and spans the time…
A: Introduction Evolution is the process of gradual, heritable change in the characteristic of the…
Q: Prototrophs A. Can grow on complete media and minimal media B. Can grow on complete media but not…
A: Introduction Prototrops are the kind of microorganism that has the same nutritional requirements as…
Q: During your experiment you analysed only a few of the recombinant clones for the presence of the…
A: A Genomic library consists of the total genomic DNA of an organism. This DNA can be stored inside…
Step by step
Solved in 2 steps
- 1. Zoologists refer to morphological and genetic similarities in animals when investigating about their evolutionary relationships, describe how these two methods work and indicate their advantages and disadvantages (at least 2 for each method). 2. Aside from the principles of evolution, a study of the interactions of organisms with their environment is also significant in understanding Zoology. Give at least two significances of studying ecology in relation to understanding animals.1. Paleontologists have constructed the following diagram to outline the evolution of the horse. Identify and explain two possible types of evidence that these scientists might have used in constructing this model. 10000 yeas g 14 to 7 million yeas g bout 20 million yeas g about 30 milion ye g about 60 mallion years ag5. All of the following are ratite birds that have undergone divergent evolution as they adapted to a flightless lifestyle on grasslands, with the exception of: A. the emperor penguin (native to Antarctica) B. the cassowary (native to New Guinea) C. the rhea (native to South America) D. the kiwi (native to New Zealand) E. the ostrich (native to Africa)
- 1. There are two main groups of bats: Smaller “microbats” navigate by using sonar, and larger “megabats” rely on vision. Mammalogists once thought that both kinds of bats evolve from insectivorous mammals. But similarities between the visual systems of megabats and primates have led some researchers to think that megabats may have evolved from primates, perhaps lemurs. What results would support the hypothesis that the two groups of bats have a common origin? Separate origins?1.Based upon the mutation that your dinosaur has, are there any environmental changes in which the non-mutants would be better adapted than the mutants? If so, which? 2.Based upon the mutation that your dinosaurs have, are there any environmental changes in which the mutants would be better adapted than the non-mutants? If so, which? Dinosaur type: Celophysis Mutation: Modification of tooth structure, causing increased specialization in diet.15. Flying squirrels, sugar gliders, and colugos are all mammals that glide using a flap of skin between the forelimbs and hindlimbs. They are not closely related and are found in North America, Australia, and Malaysia, respectively. How did they all evolve a similar structure when they are not closely related? 16. Since dinosaurs are now extinct, does that mean that birds (the dinosaurs" closest living relative according to the tree) are also on their way to becoming extinct? Why or why not?
- 7. Identify 3 species that would likely have homologous structures (structures that are constructed similarly but might have a different function such as the bones in the wings of a bat, or the bones in the fin of a whale). Explain why they are likely to have these structures?Describe how changes in the ladybugs'environment may influence their survival and/or reproduction. Make sure to use the vocabulary terms adaptation, natural selection, and polymorphic.1. Determine if the following are: HOMOLOGOUS, ANALOGOUS, VESTIGIAL structures ________1a. Human appendix and coccyx are nearly non-functional. ________1b. Bird and bat wings have the same function but are not constructed in the same way. ________1c. The upper forelimbs of humans and bats have similar skeletal structure, yet very different in appearance and function.
- 4. Bird guides once listed the myrtle warbler and Audubon’swarbler as distinct species. Recently, these birds have beenclassified as eastern and western forms of a single species,the yellow-rumped warbler. Which of the following piecesof evidence, if true, would be cause for this reclassification?(A) The two forms interbreed often in nature, and theiroffspring survive and reproduce well.(B) The two forms live in similar habitats and have similar foodrequirements.(C) The two forms have many genes in common.(D) The two forms are very similar in appearance.7. Explain how the problem of antibiotic resistance presents an example of evolution. 8. Explain how natural selection could have produced the modern long-necked giraffe from short-necked ancestors.16. Since dinosaurs are now extinct, does that mean that birds (the dinosaurs’ closest living relative according to the tree) are also on their way to becoming extinct? Why or why not?