Match the following diseases to their cause Q-Fever Psittacosis Pneumocystis Coccidiodes Blastomyces RSV flea parrot human wind soil nosocomial <
Q: A male has a particular X-linked recessive genetic disorder. His partner is normal, but her father…
A: Introduction Our biological parents pass on certain genetic traits to us. The term "X-linked…
Q: When a movement occurs, which of the following brain areas is the last one to reach its peak of…
A: The voluntary movements of the body involve the motor cortex and the associated cortex region. The…
Q: Organisms ATP NADH NADPH FADH2 Ethanol 1 20 100 0 0 50 2 350 400 0 100 1 3 500 410 200 100 1 Three…
A: Energy is spontaneously produced during cellular respiration, which involves several metabolic…
Q: The following DNA sequence is found on a chromosome in rice plants: 5’…
A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…
Q: For that same genotype: In the presence of molecule A, what functional structural proteins are…
A: Introduction Gene is a functional unit of DNA. It carries all the information of a organism. Gene…
Q: The storage of Carbon Dioxide is part of the carbon cycle. Please formulate an explanation relating…
A: Introduction to Carbon Cycle • Carbon isotopes have been very heavily utilized to study various…
Q: 4a) Which of the following is true about infants’ visual acuity? Select one: i. Poor visual…
A: Proper child development is very important in a person's life. From infancy until early adulthood,…
Q: The mismatch repair (MMR) components work closely with the DNA replication machinery
A: The mismatch repair or MMR is a process by which DNA is repaired by removing the mismatched…
Q: Determine the process by which the small RNA species identified by CDNA sequencing is considered as…
A: Transcriptome sequencing is used to identify the regulating small ribonucleic acids (SRNAs)…
Q: 2) The intermediate disturbance hypothesis proposes that __________. A. the highest diversity in…
A: Introduction: The number of various species present in an environment and the relative abundance of…
Q: Resident ER proteins destined to remain in the lumen of the ER are marked by retrieval sequences and…
A: The "Endoplasmic reticulum(ER) plays an important role, and it is where the membranes and their…
Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…
A: Introduction:- The true breeding plant varieties means that they are homozygous ( genotypically) for…
Q: please reflect on the three major subject areas 1. Evolution - including evolutionary processes,…
A: 1 evolution--Evolution is a change in the genetic composition of a population over successive…
Q: 1) Narrow sense heritability of withers height in a population of quarter horses is 17%. The average…
A: The narrow sense heritability of the hand's height of a horse population was given at 17%. The…
Q: Once a healthy biological male has reached adulthood, do his cells continue to divide by both…
A: In multicellular organisms, like humans ,Cells divide by various methods in biology. In normal…
Q: A mutant haploid strain of Saccharomyces cerevisiae (yeast) called cox2-1 was found that was unable…
A: S. cerevisiae is utilized as a prototype in biological sciences to examine conserved processes…
Q: Which among the following statements is INCORRECT? The first event in the Calvin cycle is the…
A: Calvin pathway occurs in all photosynthetic plants, that is operated in cyclic manner. Calvin cycle…
Q: Describe the formation of chromosomes
A: Answer: Chromosomes : It is the long thread like structure of proteins and a single molecule of DNA…
Q: Describe the steps including the roll of ion terminals in a neuronal action potential
A: An action potential is created when the voltage difference between the inside and outside of a…
Q: If the null hypothesis is correct, predict how the proportion of young cacti with nurse plants will…
A: The hypothesis is a supposition and explanation that is proposed. The hypothesis is made on the…
Q: Multiple choices: Question: Handedness (whether you are right or left-handed) shows a 79%…
A: Introduction Handedness in humans Handedness is defined as the better, faster, or more precise…
Q: 1 Sarah, a trainee of the electron microscopist at the local hospital, is reviewing some…
A: mitochondria is an essential organelle of cell that general energy by phosphorylation in form of…
Q: Why are severe mitochondrial or chloroplast gene mutations are usually found in heteroplasmic cells…
A: Introduction A mutation is a change to an organism's DNA sequence. Mutations can be the result of…
Q: If two heterozygous individuals that carry an allele that is 75% penetrant in the heterozygous…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: a) Viruses can have DNA or RNA genes b) Antibiotics can kill bacteria, viruses and fungi c)…
A: INTRODUCTION Answers of a to l is given below.
Q: Slime molds are ususual in their lifestyles and apperance. You might have seen one and not even…
A: Molds are tiny fungi that consume plant or animal substances to survive. Nobody knows how many…
Q: What is the lac operon?
A: The procedure of using a gene's data to generate a functioning genetic material is known as gene…
Q: Are there ways to reveal the detailedworkings of a protein machine that donot require the…
A: Proteins are dynamic biomolecules having many functions in the cell. They are the end products of…
Q: What are dietary supplements and in what situations are they "good" for you? In what situations are…
A: "Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…
Q: Mutants were isolated in which the constitutive phenotype of a missense lacl mutation was…
A: In an experiment, the mutants were isolated in which the constitutive phenotype of a missense lacI…
Q: In general, what is known about the prevalence of Hepatitis C, and how it can be transmitted? 2.…
A: Answer 1. With around 2 to 3% of the world's population carrying the illness, HCV is growing more…
Q: What are the adult derivatives of the pharyngeal pouches? 2. What is the role of the allantoic…
A: The first pharyngeal pouch lies between arches one and two. The second pharyngeal pouch sits between…
Q: 1. What cell division event is depicted above? (be as specific as possible) 2. What type of protein…
A: Cell division results in partition of genetic material into the daughter cells. During mitosis cell…
Q: Which statement about red algae and green algae is correct? A. Red algae and green algae are both…
A: Introduction Plant-like protists are called as the algae. red and green algae, euglenids, and…
Q: The sequence below represents a strand of mRNA. Draw a box around the start codon. Then use the…
A: Introduction: sequence of the three nucleotides which together form a unit of the genetic code…
Q: Give an example of tree whose removal of leaves forms a noncaterpillar tree.
A: Phylum Arthropoda has several classes and “Insecta” is the largest class among all. Insects belong…
Q: 4. In a given population of 1000 individuals, the allele frequencies are a = 0.4 and A = 0.6. What…
A: Given - Population size - 1000 Frequency of occurence of dominant allele (A) - 0.6 Frequency of…
Q: A male has a particular X-linked recessive genetic disorder. His partner is normal, but her father…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: 27) A tRNA is activated when it A) attaches to mRNA. B) attaches to its specific amino acid. C)…
A: A form of RNA molecule called transfer ribonucleic acid (tRNA) aids in the translation of a…
Q: Which is a structural gene? A. The gene that encodes ß-galactoside permease OB. Allolactose OC. The…
A: Operon is the gene regulatory mechanism in prokaryotes that regulates many genes that are involved…
Q: If a protein is acted on by a protein kinase, in what way does that change the protein’s structure?…
A: Protein kinases play an important function in cellular activation. A key component of activation is…
Q: exaplin the intracellular mehcanims of smooth msucle via agonist such as Hitamine and acytycholine.…
A: the intracellular mehcanims of smooth msucle via agonist such as Hitamine and acytycholine produces…
Q: Which cytosines could be methylated in a typical mammalian genome? Why? 5’-GCCGCGC-3’
A: DNA is the genetic material in living organisms that contain two polynucleotide trends. DNA contain…
Q: ㅇㅁㅁ ㅇㅁㅁ 미이 e pedigree shown, indicate whether each of the following inheritance patterns ssible by…
A: Mutation in any of the autosomes or sex chromosomes give rise to different types of inheritance…
Q: etermine the responsiveness of the wild-type protein to maltose, the way by which mutation affects…
A: Prior to the reporter gene transformation, the lacZ - bacteria were mutagenized. The altered…
Q: 2) Insert increase or decrease into each of the sentences below which are concerned with blood…
A: Reduced blood pressure causes the baroreceptors to provide less of a signal, which disinhibits…
Q: talk about darwins journey in tierra del feugo, don't forget to talk about the tools that he used…
A: Darwin spent nearly a year in Tierra del Fuego, exploring the islands and studying the wildlife. In…
Q: The FDA is responsible for overseeing domestic and imported foods sold in interstate commerce,…
A: Biotechnology is one of the significant branches of biology. Biotechnology can be defined as the…
Q: Membrane proteins have six possible functions (transport, cell-cell adhesion, sensing signals,…
A: Introduction-Synaptic Transmission- The synapse is the "space" between neurons or neurons and other…
Q: Vertebrate phylogenetic tree P jawless cartilaginous bony fish fish Amniotic egg Lungs Four limbs…
A: A branching graph or tree known as a phylogenetic tree illustrates the evolutionary connections…
Give a explanation answer
Step by step
Solved in 2 steps
- A fever is considered to be a ____________________________. prognosis sign symptom syndromePain is classified as a ________________________ diagnosis sign symptom syndromeMost common symptoms of Lupus ret th Lupus is difficult to diagnose because symptoms come and go with the disease. Here's how frequently various symptoms occur. di ob Percentage of Patients Who Experience It in Symptom 95% Achy joints Fever over 100 degrees 90% 90% Arthritis (swollen joints) Prolonged of extreme fatigue 81% Skin rashes 74% Anemia 71% 50% Kidney involvement Chest pain on deep breathing 08 45% 42% alaxe Butterfly-shaped rash across cheeks and nose oni30% .C8 or p Hair Loss nsAbnormal blood clotting problems Sun or light sensitivity iso enw9 27% 6 pi 20% iloe eb17% Raynaud's phenomenon (fingers turn white or blue in cold) Seizures 15% Mouth or nose ulcers 12% Source: Lupus Foundation of America, Daily Herald, December 20, 1999 31. Systemic lupus erythematosus, or lupus, affects a few million people in the United States. Most of these people are young women. Lupus is a chronic, autoimmune disease that affects connective tissue in any part of the body. An attack can damage…
- Explain each of the following:a. why the clinical signs of infection are notpresent immediately after the microorganismenters the bodyb. why infection can often be cured without drugtreatmentc. why antibacterial agents might be prescribedfor an infectionHansen's disease is also known as___?cience Mrs. Chitica LMeet-gic-wmvp-yry x e Introduction to Biology: Tutorial X rseware-delivery/ua/35033/100243327/aHR0cHM6Ly9mMS5hcHAUZWRtZW50dW0uY29tL2xYXJuZXItdWkvc2Vjb25kYXJ5L3VzZXItYXNzaWdubWVudC8zNTAzMy9sYXVuY Introduction to Biology: Tutorial ? Question O X Characters used: 178/ 15000 Type your response in the box. Two students are planning an experiment that will test how planaria (aquatic flatworms) respond to different environments. They will conduct two investigations-one that tests the worms' responses to different water temperatures and one that tests the worms' responses to different levels of acidity. Student 1 wants to buy two groups of flatworms and use a different group for each investigation. Student 2 thinks the same group of worms should be used for both investigations. Do you think either student's method would give more accurate results? Why or why not? Explain your response. Et a Student 2 thinks the same group X AVV BI UX X₂ 15px 田く Students 1 methods would be…
- what is the pathophisology of mutilple ecsrosisA 38-year-old woman came in the outpatient department because of headache.She has no vomiting, fever, changes in sensorium and nuchal rigidity. Shedescribed the headache as ”band-like” and has been occurring intermittentlyespecially during stressful situations. Vital signs and physical examinations areall normal. The physician diagnosed her as having tension headache andprescribed Acetaminophen 1g/ tab PO q6H for 3 days. The pharmacy only hasthe 250mg tablet preparation. How many tablets does she need to take perdose? How many tablets should the pharmacist give her to complete the entiretreatment regimen?The Alaska Department of Public Health was notified that foodborne illness had occurred in fishermen aboard a fishing boat off the Alaska peninsula. The fishermen had eaten steamed clams and mussels, boiled rice, boiled potatoes, and green salad. No alcohol was consumed. Symptoms experienced by the fishermen included numbness of the lips, tingling of the extremities, uncoordinated movements, incoherent speech, and nausea. Identify the etiologic (causative) agent of this outbreak of food poisoning. How did the food get contaminated, and what item was contaminated? What is the treatment, if any? How could this illness have been prevented?
