Trypsin and pepsin are both important proteases but they differ markedly with respect to: O aqueous solubility O synthetic processes O pH optima O lipase activity O secretion as zymogens
Q: Describe the evidence of Picric acid test to show a positive result for the presence of a specific…
A: Picric acid carbohydrate testing is an extremely sensitive chemical test that measures the amount of…
Q: Draw amylose and cellulose. Explain the differences Can we digest both molecules? Why or Why not?
A: Both Amylose and Cellulose are polysaccharides containing glucose residues.
Q: Propose a reasonable biosynthesis for compound 34 starting from acetyl CoA, alanine CoA, malonyl CoA…
A: Acetyl Co A is involved in my biochemical reactions (carbohydrate and lipid metabolism). It is a…
Q: What are the different solid phases that antibody or antigen can bind to, in ELISA?
A: Quantitative immunological techniques that use a solid phase can be defined as solid-phase…
Q: Why do alcohol and water separate in DNA extraction process?
A: DNA extraction is defined as a process that is used widely for carrying out the purification fo DNA.…
Q: ACTIVITY 8.2 Draw the different spontaneously formed lipid structures: a. Monolayers and bilayers b.…
A: The lipids are capable of organization into different types of structures in an aqueous environment…
Q: A protein that has been reversibly denatured has Multiple Choice temporarily lost part or all of its…
A: Each protein has its own distinct sequence of amino acids, and the interactions between these amino…
Q: If the carbonyl carbon of acetyl-CoA were marked with 14C, where would that carbon be located within…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: Which of the following monosaccharaides is a Hexose? Dihydroxyacetone phosphate (DHAP) Erythrose…
A:
Q: One treatment for hyperuricemia is administration of xanthine oxidase inhibitors like allopurinol.…
A: Hyperuricemia means a high concentration of uric acid in the blood. Hyperuricemia results in gout…
Q: The trypsin enzyme is able to hydrolyze a peptide substate at the carboxyl side of an Arg or Lys…
A: Enzymes are protein molecules that increase the rate of enzyme reactions by decreasing the…
Q: Is the claim "Our product contains no cholesterol" in coconut oils true? Why or why not?
A: Oils is a commonly usable chemical for various uses.Oil is nonpolar chemical substance which is…
Q: Predict the relative intensity and wavelength maxima for the given molecules and stated conditions.
A: Intrinsic fluorescence is observed due to three aromatic amino acid residues - phenylalanine,…
Q: 1. Where is insulin synthesised and in what form is it stored in the body? 2. Describe the mechanism…
A: Insulin is a peptide hormone composed of 51 amino acids. Insulin is the hormone, which regulates the…
Q: a. Maltose contains 2 glucose units linked α1,4 and is a reducing sugar. i. True ii. False b.…
A: Maltose is derived from enzymatic hydrolysis of amylose.
Q: Which enzyme activity of the glycogen debranching enzyme is operating during the release of glucose…
A: The amylo-1, 6-glucosidase catalytic action of glycogen debranching enzyme permits it to hydrolyze…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: AH° reaction = EH° products -EH° reactants AS° reaction = Es° products -ES° reactants %3D %3D 6CO2…
A: H is enthalpy. Enthalpy is the total energy or heat content in the universe. ∆H is the change…
Q: 2.Why is it important for eukaryotic DNA to have multiple origins of replication, when a single ori…
A: DNA is a deoxyribonucleic acid. It is the main genetic component of eukaryotes and basic unit of…
Q: 1. What happens to the rate of liver glucose metabolism during moderate intensity exercise? 2. Would…
A: Carbohydrates are the main energy source for body, they broke down in to glucose as the sole ATP…
Q: The metabolic function of the pentose phosphate pathway is to: a. generate NADPH and pentoses for…
A: Pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway for…
Q: 4. The diagram below illustrates time dependent O₂ uptake by isolated skeletal muscle mito- chondria…
A: The mitochondrial respiration process involves the activation of the electron transport chain. The…
Q: Oxidative phosphorylation generates ATP using the reducing power of [NADH, FADH2 or malate] to move…
A: In the electron transport chain there are three large multiprotein complexes that can serve as…
Q: BSA (mg/ml) Absorbancy 540nm 0 0.158 1 0.210 2 0.260 3 0.305 4 0.360 5 0.410 6 0.455 7 0.510 8 0.530…
A: Biuret test is a chemical test used for detecting the presence of peptide bonds, in whose presence…
Q: When the cell needs both NADPH and ATP, the most likely utilization of the Pentose Phosphate Pathway…
A: The pentose phosphate pathway synthesizes NADPH and pentose sugars required by the cells. The…
Q: ______ 1. is the name of the enzyme that catalyzes the hydration of carbon dioxide to bicarbonate…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. The CO2 formed in the…
Q: a. The first step in the pay-off phase of glycolysis is the oxidation of glyceraldehyde-3-phosphate…
A: Glycolysis is the pathway which breaks down glucose into two three-carbon compounds and also…
Q: SARS-CoV (P SARS-CoV-2 ( 48 h G 1201 Cell- Cell- 100 I Percentage (%) 80 60- 40- 20- SARS-CoV (PV)…
A: Gluc activity was used as a waveform to evaluate the cell-to-cell and cell-free infectious disease…
Q: The two main goals of the citric acid cycle are: (a) citrate synthesis and gluconeogenesis…
A: The citric acid cycle was discovered by H. A. Kreb. The reactions of the citric acid cycle occur in…
Q: 135.) In the citric acid cycle, oxidoreductases are reversible. A) 0 of 4 B) 1 of 4 C) 2 of 4 D) 2…
A: The citric acid cycle oxidizes the acetyl Co-A into the carbon dioxide in the mitochondria. The…
Q: Each of the following enzymes are similar in that they are all regulation points for the…
A: Enzymes are chemical substances that function in several biochemical reactions and help in the…
Q: β-oxidation is a series of reactions that cleaves carbon atoms from the carboxyl end of a fatty…
A: The fatty acids generated during the digestion of triglycerides and other lipids are broken down in…
Q: Upon digestion of starch, isomaltose (an isomer of maltose), one of its degradation products, is…
A: Isomaltose is a disaccharide similar to maltose, but with an α-(1-6)-linkage instead of an…
Q: autocatalysis of pepsinogen by pepsin is an example of a. negative feedback. b. positive feedback.…
A: pepsinogen is a powerful and abundant protein digestive enzyme secreted by gastric cells then…
Q: Determine the p50 for variant A to the nearest 5 torr (i.e., if the p50 was 12, you would write 10).…
A: The oxygen haemoglobin dissociation curve plots the proportion of haemoglobin in its saturated form…
Q: Which of the following is false? a. Methyl, phosphoryl, adenyl, uridylyl and adenosine diphosphate…
A: Enzymes are basically proteins that are intricately packed inside with the help of intramolecular…
Q: Describe the morphology and identification of Group A Streptococcus
A: Streptococci are microscopically bacterial coccoid cells, as well as a Gram-positive color when Gram…
Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…
A: Sickle cell disease is a disorder of red blood cells that are inherited. This is a disease that is…
Q: Does different kinds or types of tea produces different amount of caffeine content? Why? Why does…
A: Caffeine is categorized as a type of a bitter substance. The caffeine occurs in a number of…
Q: Current research indicates that the cause of obesity is multifactorial. Briefly outline the roles of…
A: Obesity is a major health issue in developed countries, and it has become increasingly clear that…
Q: all dehydrogenase reactions are variations upon a theme. Within that set of reactions, all reactions…
A: Dehydrogenases is an enzyme belongs to the class of oxidoreductase enzyme. In oxidoreductase the…
Q: Which of the following statements about anabolism is false? O As a rule, the anabolic pathway by…
A: The combined reactions of catabolic pathways and anabolic pathways inside the cell are known as…
Q: Long explanations are not needed. Direct answers would suffice. ***kind of in a hurry so having the…
A: Maltose is a disaccharide, made up of two glucose units. Glycolysis involves the conversion of…
Q: Snake venom contains many hydrolase enzymes, including several serine proteases. One such protease…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Just answer the items with no answer yet, thank you!
A: Maltose is a disaccharide composed of α-D-Glucose molecules, which are linked together through α…
Q: How many molecules of Pyruvate can form from Glycerol metabolism as a by-product of fatty acid…
A: The major precursors of gluconeogenesis are lactate, glycerol, alanine, ketone bodies like…
Q: what is the relative activity and the degree of inhibition caused by a competitive inhibitor when…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy.…
Q: Modified true or false. If false, replace the underlined word with the correct answer.
A: Glycolysis is a metabolic pathway, through which the glucose molecules are metabolized to synthesize…
Q: Pls help ASAP, thank you! "Which features of glucose metabolism & regulation in the liver are…
A: The liver plays important role in maintaining the blood glucose levels in the blood. When the blood…
Q: 14. In an a-helix, a hydrogen bond is formed between the carbonyl oxygen of the residue and the…
A: The alpha helix is a type of secondary structure of the protein. They are stabilized by hydrogen…
Help me please
Step by step
Solved in 3 steps
- Explain whether the specificity of interaction will be high or low for each given situation. a. The value of KD of the ligand's interaction to the target receptor is very much lower than the value of KD of the ligand's interaction to off-targets. b. The ligand concentration [L] is higher than the KD value of its interaction with the target and the KD value of its interaction to off-targets.Mr PL was administered Drug A that acts on a particular receptor. Unfortunately, it was given in overdose and produced an adverse effect. Drug B is then administered which blocks that receptor. The effect of drug B results in a reduction in the effect of drug A. Comment on if Drug B is acting competitively (reversibly) or non-competitively (irreversibly)? Provide one suitable clinically relevant example of such interaction.Choose the best term which describe the following statement: antagonist binds to the binding site of receptor and change the shape: Select one: Incorrect Induced fit. Correct induced fit. Signal transduction. Perfect fit.
- You can choose one or more than one option The dissociation constant (Kd) of a receptor is: BIOCHEMISTRY basic the concentration of a ligand that produces 100% occupancy of the receptor the concentration of a ligand that produces 50% of the maximal effect. the measurement of specificity between ligand and its receptor. the measurement of speed by which a ligand will dissociate from its receptor. the measurement of affinity between a ligand and its receptor and the inverse of the association constant. During an experiment with Drosophila, it was discovered that all females had red eyes. unlike males. A conclusion based on this observation would be: MOLECULAR BIOLOGY basic The gene for eye color is located on the X chromosome. The females are homozygotes The gene for eye color is dominant. The eye color results from multigenic linkage. The eye color phenotype is sex-linked A secondary lysosome: CELL BIOLOGY advanced a lysosome that provides a backup to the primary…What will be the receptor probability of the active state after you add a high dose of an antagonist?You can choose one or more than one option The dissociation constant (Kd) of a receptor is: the concentration of a ligand that produces 100% occupancy of the receptor the concentration of a ligand that produces 50% of the maximal effect. the measurement of specificity between ligand and its receptor. the measurement of speed by which a ligand will dissociate from its receptor. the measurement of affinity between a ligand and its receptor and the inverse of the association constant.
- From the Hill Plot below, the of the first binding event for the receptor-ligand system under study is: Q1 4nM Ο 10 μΜ -2 nM 2 nM Calculate the Hill Coefficient from the receptor-ligand binding data below: Q2 4 100 2 3 (0-1) 60 log 10 8 6 4 2 0 -2 -4 -6 -6 -4 -2 0 2 4 log [L] (nM) 6 8 10Which of the following statements most accurately describes what happens when an antagonist binds to a receptor? The antagonist binds non-covalently to the receptor and promotes internalisation of the receptor. Antagonist binding alters the structure of the receptor making it unable to function normally. At sufficiently high concentrations the antagonist can prevent the receptor from binding to its natural (endogenous) ligand. The antagonist-receptor complex binds to a heterotrimeric G protein forming a stable and inactive ternary complex.Explain whether the specificity of interaction will be high or low for each given situation. a. The concentration of the ligand's complex to the target receptor equates to the concentration of the ligand's complex to off-targets. b. The target receptor's total concentration is very much higher than the off-target's total concentration.
- Estimate the binding affi nity of a ligand for its receptor from the followingdata:A ligand binds two different receptors with a Kd value of 10−7 M for receptor 1 and a Kd value of 10−9 M for receptor 2. For which receptor does the ligand show the greater affinity? Calculate the fraction of receptors that have a bound ligand ([RL]/RT) in the case of receptor 1 and receptor 2 if the con- centration of free ligand is 10−8 M.The top panel (a) of this figure shows the graded potential change (far right, upper, electrical trace) that results from ligand binding to the ligand gated Na+ channel. The bottom panel of this figure (b) shows a graded potential change (far right, lower, electrical trace) that results from ligand binding to a ligand gated Cl- channel. From this trace you know (Vm = -70 mV) 1. ECl- is -70 mV 2. ECl- is more negative than -70 mV (i.e., -80 mV) 3. ECl- is more positive than -70 mV (i.e., -60 mV)