Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated into amino acids. Complete the DNA-to-amino acid table for three consecutive codons with the appropriate nucleotides and amino acids using a codon table. Nucleotide and amino acid options can be used multiple times or not at all. 5' to 3' DNA strand T T A G A G 3' to 5' DNA strand A A T C T C G C G transcribed mRNA U U A G A G C G C TRNA anticodon A. A U C U G C G amino acid leucine glutamic acid Answer Bank A glutamic acid leucine cysteine arginine proline U

Using the genetic code, interpret the following set of nucleotides. AUGGGUCCAUGGCGUAGGCCAAAUGAUGAGGAAUGA

Match the THE BEST DESCRIPTION with the proper enzyme. RNA Polymerase I RNA Polymerase II RNA Polymerase III DNA Polymerase I aminoacyl-tRNA synthetases DNA Polymerase III RF1 [Choose ] ✓ MAINLY synthesizes ribosomal RNA Recognizes stop codons and halts the process of protein translation The most important enzymes involved in interpreting the genetic code. Part of a processive complex that does most of the work placing nucleotides in DNA replication. Synthesizes messenger RNA precursors MAINLY synthesizes transfer RNA Has 5' to 3' exocnuclease activity and participates in primer removal MAINLY synthesizes transfer Has 5' to 3' exocnuclease act The most important enzyme Part of a processive complex Recognizes stop codons and

Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences.  UGCGAUGGCAAUCGGUGUACCCCUGACUGAGC

5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help answer the questions below. 5' AUG/CCU/ACG/GAC/UGG/CCU 3¹ First Letter U C A The genetic code Second Letter A U с G phenylalanine serine tyrosine cysteine phenylalanine serine tyrosine cysteine leucine serine stop G leucine leucine leucine leucine leucine serine proline isoleucine start/ stop histidine stop tryptophan arginine proline histidine arginine proline glutamine arginine proline glutamine arginine threonine asparagine serine isoleucine isoleucine threonine asparagine serine threonine lysine arginine threonine lysine arginine methionine valine valine valine valine a. What polypeptide would be generated by this sequence? alanine aspartate glycine alanine aspartate glycine alanine glutamate glycine alanine glutamate glycine Third Letter DUAGUUAGUUAG C с А UCAG b. The RNA is mutated to: 5' AUGCCCACGGACUGGCCU 3. What type of mutation has occurred? Show the new polypeptide chain. c.…

The following sequence of DNA is part of the normal, wild-type gene.   5'TAC CGG GAC TTG AGC CGA TAG 3'   A deletion occurs during DNA replication, causing the guanine shown in red to be removed from the nucleotide strand. What effect is this most likely to have on the final protein?   Multiple Choice   The deletion of the G will cause a single amino acid substitution in the codon in which it occurs.   The deletion of the G will cause a frameshift, so that the first amino acid after the mutation will change but the rest of the protein is unaffected.   The deletion of the G will cause a frameshift, resulting in a premature stop codon and a truncated protein.   The deletion of the G will cause a frameshift, resulting in the loss of the normal stop codon and an abnormally long protein with an altered amino acid sequence.   The deletion of the G will not have an effect on the final protein.

Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the following code: 5’-ACT-ACT-CTA-AGC-CCC-TAC-CCG-3’

Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c.   Using the genetic code, write the amino acid sequence translated:

Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3' Second position First position (5' end) Third position (3' end) Phe Ser Tyr Cys U Phe Ser Тут Cys Leu Ser Stop Stop A. Leu Ser Stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg Ile Thr Asn Ser U Ile Thr Asn Ser Ile Thr Lys Arg A Met Thr Lys Arg Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly O a. Lys-His-Ala-Gly-Asn-Leu-Val O b. Val-Val-Ser-Pro-Leu-Asp-Thr

Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid would be what