Karenca was studying her genetics notes the night before the test. She was getting a little turned around with the differences between DNA and RNA. She started working a problem that gave a segment of original DNA as follows: ТА Then, the problem said that original DNA was mutated to become: TAG Use the codon table to help Karenca determine whether or not this mutation will cause a change in the phenotype (what the organism looks like) of the organism. Even though the DNA sequence changed, the sequence still codes for the same amino acid, so no change in phenotype will occur. Yes, the phenotype of the organism would change because a new amino acid will be coded for. Yes, the phenotype of the organism would change because any change in the DNA sequence will cause a change in phenotype. It is impossible to determine if a change in phenotype will occur using only the DNA sequence.

Karenca was studying her genetics notes the night before the test. She was getting a little turned around with the differences between DNA and RNA. She started working a problem that gave a segment of original DNA as follows: ТА Then, the problem said that original DNA was mutated to become: TAG Use the codon table to help Karenca determine whether or not this mutation will cause a change in the phenotype (what the organism looks like) of the organism. Even though the DNA sequence changed, the sequence still codes for the same amino acid, so no change in phenotype will occur. Yes, the phenotype of the organism would change because a new amino acid will be coded for. Yes, the phenotype of the organism would change because any change in the DNA sequence will cause a change in phenotype. It is impossible to determine if a change in phenotype will occur using only the DNA sequence.

Name: Karenca was studying her genetics notes the night before the test. Sh
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Karenca was studying her genetics notes the night before the test. She was getting a littleturned around with the differences between DNA and RNA. She started working a problemthat gave a segment of original DNA as follows:ТАThen, the problem said t

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 13QP: A frameshift mutation is caused by a: a. nucleotide substitution b. three-base insertion c....

See similar textbooks

Similar questions

Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU Socond letter Key: Ala = Alanine (A) Arg Arginine (R) Asn = UUU } UAU Tyr UGU UGC Cys UGA STOP UGG Trp UCU UCC UUC Phe Ser Asparagine (N) Asp = Aspartate (D) Cys Cysteine (C) Gin = Glutamine (Q) Glu = Glutamate (E) Gly = Glycine (G) His = Histidine (H) le = Isoleucine (1) Leucine (L) Lys Lysine (K) Met = Methionine (M) Phe = Phenylalanine (F) Pro Proline (P) Ser = Serine (S) Thr Threonine (T) Trp Tryptophan (W) Tyr Tyrosine (Y) - Valine (V) UCA UCG UAA STOP UAG STOP UUA Leu UUG S CCU CC CGU CUU CUC His CGC Arg Leu Pro CAA Gin CGA CCA CCG CUA CUG CGG Leu = AGU AUU AUC } lle AUA ACU ACC ACA Ser AAC…
Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The mutation is underlined. A codon table can be reached by clicking this link. CGA to UGA O silent O frameshift O nonsense O missense
Transcribe and translate the mutated sequence #3. Determine the consequence, if any, for each mutation. You will need to use your codon charts in your ISN. Practice with both charts.
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Pro
In the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútation
What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5' Mutant: 3'-AGTCCCTGCAAT-5' Use the codon table if you need it. Answer choices: Deletion, Insertion, Missence, Silent I selected missence, but the answer is incorrect. Please help.
What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your answer.
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group B - MUTATION 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C- 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’
A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility