Based on the following wild type DNA sequence, indicate if each of themutations should be classified as : insertion, deletion, missense, nonsense,silent (Use the provided Genetic Code table and remember you have beengiven DNA sequence).Wild Type: AUGAUUCUUAAAAGUMutant 1: AUGAUUCUUUAAAGUMutant 2: AUGAUUCUUGAAAGUMutant 3: AUGAUCCUUAAAAGUMutant 4: AUGAUCCUAAAAGUMutant 5: AUGAUCCUUAAACAGUSocond letterKey:Ala = Alanine (A)Arg Arginine (R)Asn =UUU}UAU TyrUGUUGC CysUGA STOPUGG TrpUCUUCCUUCPheSerAsparagine (N)Asp = Aspartate (D)Cys Cysteine (C)Gin = Glutamine (Q)Glu = Glutamate (E)Gly = Glycine (G)His = Histidine (H)le = Isoleucine (1)Leucine (L)Lys Lysine (K)Met = Methionine (M)Phe = Phenylalanine (F)Pro Proline (P)Ser = Serine (S)Thr Threonine (T)Trp Tryptophan (W)Tyr Tyrosine (Y)- Valine (V)UCAUCGUAA STOPUAG STOPUUALeuUUG SCCUCCCGUCUUCUCHisCGCArgLeuProCAA GinCGACCACCGCUACUGCGGLeu =AGUAUUAUC } lleAUAACUACCACASerAAC AsnAGCThrAGAACGAAG LysAGG ArgAUG MetGUUGUCGCUGCCGGTGGCGlyGGAGAC Asp%3DValAlaGUAGUGGCAGCG)GluGGG)ValThird letterUCAGUCAOUCAOFirst letter

The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU

Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Can I have some help with the following question ,thank you!
______________ is a kind of spontaneous mutation that results from a short-term, reversible phenomenon that leads to abnormal base pairing during DNA replications, followed by another round of DNA replication which results in one of the two daughter DNA molecules containing a point mutation. Group of answer choices Tautomeric shift Frameshift mutation Nonsense mutation Pyrimidine dimer Conditional mutation
For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
FIGURE 5 shows the base sequence of the DNA before and after mutation. Which of the following are CORRECT about the types of gene mutation? * Normal DNA: CGA TTA CCA TGC ATA CGA TTA ACC ATG CAT A CGA TTA CAC TGC ATA I III CGA TTA CCA GGC ATA II Mutant DNA Types of gene mutation I Base Deletion II Base Substitution II Base Inversion FIGURE 5 O I and Il only O I and III only Il and III only O I, Il and III
Restriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…
You can select multiple answers.
As the leading scientist in a biomedical science laboratory, it is a requirement to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the C01 gene of 750bp. 2.1. They observe no band appearing on an agarose gel. What would be your conclusion? 2.2. They observe three bands of different sizes that resemble a smear on the gel. Advice 2.3. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their condusion? Explain. 2.4. Explain how PCR can be used to detect infectious agents in diagnoses of diseases.
The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AA
Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5’-3’.
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'