Q: What are the known exceptions to the genetic code?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…
A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…
Q: Explain Exon shuffling via recombination between homologous interspersed repeats.
A: Answer: Introduction: Exon shuffling is a process of the production of new genes. It is a mechanism…
Q: Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than…
A: An intron is any nucleotide sequence within a gene that is removed by RNA splicing during maturation…
Q: Name four major classes of DNA-binding proteins that are responsible for controlling transcription,…
A: Replication protein A Transcription factor TAL effectors Zinc finger
Q: Explain why all transposons include inverted repeats.
A: Transposable elements (TEs) are deoxyribonucleic acid (DNA) sequences that move from one location to…
Q: 1. You are working with a known chemical that can cause a mutation in the DNA. You decide to use the…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What does “Universality and Degeneracy” of the Genetic Code mean? State the significance of both the…
A: The genetic code is said to be nearly universal. It means that a given codon specifies the same…
Q: A gene contains eight sites where alternativesplicing is possible. Assuming that the splicing…
A: according to the question, A gene contains eight sites where alternative splicing is possible:
Q: Describe the organization of sequences within different types of transposable elements.
A: Transposable elements are the sequences in the genome that can move within the genome from one…
Q: Discuss the effects of transposable elements on gene function.
A: Transposable elements also known as jumping genes these are short sequences of DNA that have the…
Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…
A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…
Q: mutant appear on a gel in comparison
A: Point mutations can cause serious changes to an organism if they change the way a protein works By…
Q: One mutation is a deletion of six nucleotides in the second exon of the gene and the other mutation…
A: Introns and exons are nucleotide sequences within a gene in mRNA. The conversion of DNA to RNA is…
Q: Suppose that a 20-bp deletion occurs in the middle of exon 2 of the gene. What will be the likely…
A: Alternative processing and splicing results in the production of multiple mRNA and proteins from…
Q: three different types of loss of function mutations and in each case explain how the mutation exerts…
A: A mutation is any alteration of the base sequence of the DNA or RNA. Since mutation alters the base…
Q: An important validation of the genetic code occurred when George Streisinger determined the amino…
A: It is given that the specific single-base insertion mutation could be suppressed, with wild-type…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…
Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…
A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…
Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…
A: Transcription is a process in which one strand of DNA known as template strand is known as converted…
Q: Discuss how mutations may arise in DNA, and the potential consequences…
A: Mutations are the changes in the nucleotide sequence of DNA and it arises at the time of DNA…
Q: Do you think that the alternate splicing of exons may enable a structural gene to code for several…
A: Alternative splicing is a basic regulatory process of gene expression. This process is very…
Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…
A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…
Q: Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What…
A: Unconstrained DNA sequence which are those sequences whose evolution is unaffected by selection are…
Q: Name four types of point mutations that can occur in a gene coding for a protein. Discuss the…
A: The DNA (deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Define the following terms: a. open reading frame b. degenerate coding system c. nonoverlapping…
A: Note: Since you have posted a question with multiple subparts, we will solve the first three…
Q: What is meant by the statement “The genetic code is universal”? What is the significance of this…
A: DNA is deoxyribonucleic acid that contains genetic information. Gene is a segment of DNA that can…
Q: Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?…
A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…
Q: What are The Effects of Mutations on Polypeptides Helped Verify the Code?
A: DNA is a molecule that is both complex and adaptable. As such, as the product of a process called…
Q: Identify the DNA elements and protein factors, #1- 7, in the figure below that are involved in the…
A: Central Dogma = According to the central DNA is converted to RNA (transcription) and RNA to protein…
Q: In the genetic code, both AAU and AAC code for asparagine. For this reason, the code is said to be…
A: Most of the amino acids are encoded by two or codons, which shows nonambiguity, and that code is…
Q: Define Nonoverlapping code as they apply to the genetic code
A: The set of rules that allows genetic material information to get translated into proteins is called…
Q: An ORF 1,200 bp in length can encode a protein of what size?
A: Proteins Proteins are the building block of our body they are synthesized by the process of…
Q: The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your…
A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…
Q: Please give one observation of the genetic code that indicates it minimizes the harmful effects of…
A: Changes in the genetic sequence of a gene that can alter the expression of a genotype are called…
Q: Describe the effects of nonsynonymous, synonymous, andnonsense mutations on a protein and the…
A: Non-Synonymous mutation: - Mutations which alter the amino acid sequence of a protein. Synonymous…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…
A: The coding sequence of the Gene F and G are given as 5'…
Q: Which of the following mutations would have the greatest negative impact on the protein product of a…
A: Mutations are studied to understand the genetic mechanism behind the development of the disease.…
Q: Based on this alignment, you can identify areas of the protein sequences that are key regions of the…
A: Multiple sequence alignment is used to obtain optimal matching between three or more sequences of…
Q: Define Nonuniversal codons as they apply to the genetic code
A: The rules that are followed by living cells to synthesize proteins from mRNA is called genetic code.…
Q: Computer programmers, working with molecular geneticists, have developed programs that can identify…
A: Transcription is the process by which the information in a strand of deoxyribonucleic acid (DNA) is…
Q: identify all the amino acid-specifying codons in thegenetic code where a point mutation (a single…
A: The mutation is sudden change occurs in genetic material. It can be due to ultra-violet rays,…
Q: Describe four differences between prokaryotic and eukaryotic gene expression.
A: Genetic is the branch of science that deals with genetic material like genome, genes, DNA, and…
Q: A transposable element is found to encode a reverse transcriptase enzyme. On the basis of this…
A: Transposable elements are known as stretches of DNA molecules and they can move from one place to…
Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…
A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…
Q: Discuss how degeneracy of the genetic code makes cells more robust to mutations.
A: Nucleic acids are biomolecules that form the genetic material in organisms. There are mainly two…
Define FOUR (4) types of point mutations within coding sequences
Step by step
Solved in 2 steps
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionA molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
- What does “Universality and Degeneracy” of the Genetic Code mean? State the significance of both the code’s Universality and Degeneracy.A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possibleWhy did geneticists believe, even before direct experimental evidence was obtained, that the genetic code would turn out to be composed of triplet sequences and be non-overlapping?Experimentally, how were these suppositions shown to be correct?