in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized RNA strand? Write the sequence from 5’ to 3’. What is the sequence of the template DNA strand? Write the sequence from 5’ to 3’

If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its complementary strand?                                5’ACCGATTACGATTACG3’     If the template DNA strand has the nucleotide sequence below, what is the nucleotide sequence on mRNA?                                5’ACCGATTACGATTACG3’       In the chart below, indicate the unique structural or functional characteristics of DNA and RNA, as well as their similarities. Be very specific.   Unique DNA characteristics Similar characteristics Unique RNA characteristics

Sequence 1 : TACGCTACGGTAATC Sequence 2: TACGCTACTATCGTA

Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table

Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5'  <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'

An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position C UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu his ССС pro ССА CỤC САС CGC arg CỦA САА CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asn ser AUC ile ACC thr АCА AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GUC GCC ala GCA GẠC GGC val gly GUA GAA GGA glu GUG GCG GAG GGG glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg) Third position (3'-end) AGUCAG First position (5'-end)

Provide the sequences of the template and coding strands of a DNA double helix that was used to produce this RNA: 5'-AUUACGGUCUAU. Be sure to label the 5' and 3' ends.

Give the sequence of the LEFT (5'-end) region of this RNA strand that would participate in forming the stem of a stem-loop with this bit of RNA. DRAW this stem-loop in your scratch work!     5’-UGGUGGAUCUCUGCAACUGAUCCAUUG-3’

When given the DNA message sequence, 5'-ACT-3', what would be the corresponding DNA template strand and MRNA codon? O DNA template is 3'-UGA-5. MRNA codon is 5'-ACT-3' O DNA template is 5'-ACU-3'. MRNA codon is 3'-TGA-5'. O DNA template is 3'-ACU-5'. mRNA codon is 5'-TGA-3' O DNA template is 3'-TGA-5'. MRNA codon is 5'-ACU-3' 1 Previous Next

Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen.  xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx