Please answer A, B, and C for codon sequence 5 only 15'-TACCGAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTAGTGCCGCGAGAATTATAG-3'2 5'-TACCCAGATAATATATACGCATGACACATATGGACACAGATTATAAAGATATCTAGTGCCGCGAGAATTATAG-3′3 5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATAATAAAGATATCTAGTGCCGCGAGAATTATAG-3'4 5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTAGAAAGATATCTAGTGCCGCGAGAATTATAG-3'5 5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTATCAAAGATATCTAGTGCCGCGAGAATTATAG-3′65'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTAGTGCCGCGAGGATTATAG-3′ Use the sequence of DNA below as your reference point; this single-stranded DNA sequence isthe coding strand of a gene, which means the mRNA sequence is identical (not complementary)to this sequence except that T's are replaced with U's. You do not have to convert any part ofthe DNA sequence into a complementary strand for this part of the assignment - youshould just use the DNA sequence as given.Note: for simplicity, not every sequence needed for gene expression is included in this gene -for example, you won't necessarily find a Shine Dalgarno sequence in the mRNA 5' UTR. Useonly the information labeled on the DNA sequence to answer each question.Promoter5' UTRCoding regionTranscription start site5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTĄCTGCCGCGAGAATTATAG-3′3' UTRTranslation start codonTranslation stop codonFor each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. Forall examples, the mutation is highlighted in orange. A codon table is provided on the secondpage for your reference. Answer each of the following questions for EACH DNA sequence:A) what type of mutation is shown based on the nature of the genetic change(frameshift mutation or point mutation; if a point mutation, transition or transversion)B) what type of mutation is shown based on the functional impact on the organism(frameshift, silent, missense, nonsense, noncoding)C) What do you predict the effect of that mutation will be on either the structure orfunction of a protein, or on the phenotype of the organism. Explain your answer.For this part, there are some examples where you should know exactly the effect ofthe mutation, and some where you may have to infer this information based on thelocation of the mutation.

Name: Please answer A, B, and C for codon sequence 5 only 15'-TACCGAGATAATAT
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Please answer A, B, and C for codon sequence 5 only 15'-TACCGAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTAGTGCCGCGAGAATTATAG-3'2 5'-TACCCAGATAATATATACGCATGACACATATGGACACAGATTATAAAGATATCTAGTGCCGCGAGAATTATAG-3′3 5'-TACCCAGATAATATATACGCATGACACATATG