
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
Please answer A, B, and C for codon sequence 5 only

Transcribed Image Text:15'-TACCGAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTAGTGCCGCGAGAATTATAG-3'
2 5'-TACCCAGATAATATATACGCATGACACATATGGACACAGATTATAAAGATATCTAGTGCCGCGAGAATTATAG-3′
3 5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATAATAAAGATATCTAGTGCCGCGAGAATTATAG-3'
4 5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTAGAAAGATATCTAGTGCCGCGAGAATTATAG-3'
5 5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTATCAAAGATATCTAGTGCCGCGAGAATTATAG-3′
65'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTAGTGCCGCGAGGATTATAG-3′

Transcribed Image Text:Use the sequence of DNA below as your reference point; this single-stranded DNA sequence is
the coding strand of a gene, which means the mRNA sequence is identical (not complementary)
to this sequence except that T's are replaced with U's. You do not have to convert any part of
the DNA sequence into a complementary strand for this part of the assignment - you
should just use the DNA sequence as given.
Note: for simplicity, not every sequence needed for gene expression is included in this gene -
for example, you won't necessarily find a Shine Dalgarno sequence in the mRNA 5' UTR. Use
only the information labeled on the DNA sequence to answer each question.
Promoter
5' UTR
Coding region
Transcription start site
5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTĄCTGCCGCGAGAATTATAG-3′
3' UTR
Translation start codon
Translation stop codon
For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For
all examples, the mutation is highlighted in orange. A codon table is provided on the second
page for your reference. Answer each of the following questions for EACH DNA sequence:
A) what type of mutation is shown based on the nature of the genetic change
(frameshift mutation or point mutation; if a point mutation, transition or transversion)
B) what type of mutation is shown based on the functional impact on the organism
(frameshift, silent, missense, nonsense, noncoding)
C) What do you predict the effect of that mutation will be on either the structure or
function of a protein, or on the phenotype of the organism. Explain your answer.
For this part, there are some examples where you should know exactly the effect of
the mutation, and some where you may have to infer this information based on the
location of the mutation.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 3 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Use the first picture and codon table to answer the following questions.arrow_forwardFirst letter U U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine A AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG C Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC A CAA CAG Histidine Glutamine AAU AAC Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC AGA AGG Arginine GGA GGG AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC Arginine Serine Glycine Which mutation could result in the removal of a site for glycosylation or phosphorylation? DOAGUO AGUO AGUAG Third letter сarrow_forwardThis question refers to the mRNA sequence below: 5-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else, so that Moodle can grade your question correctly.arrow_forward
- please answer the highlighted questionarrow_forwardPlease write a paragraph and include an image about Translation and use the following terms (in the paragraph): ribosomal attachment, 5’ end, start codon, codons, genetic code, tRNA, stop codonarrow_forwardPlease answer A, B, and C for codon sequence 4 onlyarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education