sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence  5’-TAT-GGC-ATG-3’?       Ile-Arg-Pro     His-Ala-Ile     Tyr-Gly-Met     Val-Arg-Tyr     Ile-Pro-Tyr

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: Match the mutation with the correct name. Not all labels are used. Nonsense Mutation Mismatch…

A: Any change in the DNA sequence is known as mutation. Some of the mutations are responsible for…

Q: Explain how the use of radiolabeled aminoacids in this procedure helped to reveal the genetic code.

A: Introduction  In 1964, two eminent scientists Marshall W. Nirenberg and Philip Leder carried out the…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: What is the sequence in the template DNA strand during RNA production that encodes the codon GCU?…

A: Translation is the process of formation of mRNA transcript on DNA template strand.

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: Choose the correct answer from the list. is a DNA binding site. protects coding sequences at the 5'…

A: All these terms are related to synthesis of biomolecules by the processes such as transcription and…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify…

A: Note- according to our guild line we are supposed to answer only one question. Please repost the…

Q: 3 ‘  TACGCCAGTGGTTCGCAC  5   Give the base sequence of the complementary DNA strand.  Give…

A: Base sequence of template strand this 3 ‘  TACGCCAGTGGTTCGCAC  5 is  5' ATGCGGTCACCAAGCGTG 3'   mRNA…

Q: CT/TGT/AAG/ACC/TTT What would be the amino acid sequence created from this mutated DNA strand?

A: The central dogma theory in genetics is based on the processes of Replication, Transcription and…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5…

A: DNA replication :-  It is the formation of a new DNA from a pre existing DNA.  The DNA so formed is…

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: Give typing answer with explanation and conclusion  Which of the triplets below is a possible…

A: Production of protein from the mRNA is known as translation in which tRNA is responsible for…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.  The alpha…

Q: Describe the term SDS-PAGE.

A: Charged particles migrate during electrophoresis under the influence of an electric current. For…

Q: You create a premature stop codon as a result of an induced mutation in the lab. What type of…

A: Premature termination codons (PTCs) are the result of one-nucleotide changes that transform a…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…

Q: What is the nucleotide sequence of the complementary strand of this molecule AT GCGA? O CATAG O A AT…

A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are well known and well defined as the two…

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this…

A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…

Q: The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide…

A: Transcription is the process of converting a portion of DNA into RNA. RNA polymerase is the enzyme…

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: Choose a pentapeptied composed of five different amino acids.  List the five amino acids.…

A: mRNA strand is synthesized from the template strand of the DNA by transcription. This mRNA is…

Q: Write the complementary sequence for TCGAAC. Write the new sequence in the standard 5' → 3'…

A: DNA structure, base-pairing rules, and the 5' → 3' notation.1. DNA Structure:DNA (Deoxyribonucleic…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: A segment of DNA is shown below. This segment is located in the region of a gene near where…

A: Formation of a hair loop structure at the end of the termination site results in the termination of…

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: Consider the RNA sequence 5' AUGUUAGAUCGG 3' transcribed from the DNA molecule below. 1. 5'…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…

A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…

Q: Induce a silent mutation in the template strand. Illustrate the output.

A: Mutation changes the sequence of nucleotides in a gene. The mutation is a random process.

Q: The letters below represent a DNA strand. Determine the complementary DNA sequence by following the…

A: DNA replication is a biological process that occurs in living cells during which the DNA molecule is…

Q: the following segment of DNA codes a protien. 5' - TGATGATATTCCAgaargGATG AGCaataGCACATTGATA-3

A: Post-transcriptional modification of m RNA involves the removal of all the introns and linking up of…

Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…

A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase ODNA…

A: Option 4 is the answer.RNA polymerase.

Q: Produce the RNA strand that would be read from the DNA strand T -- A C -- G C -- G A -- A -- C -- G…

A: DNA to RNA Transcription Process 1. Understanding DNA and RNA:DNA (Deoxyribonucleic Acid): It…

Q: EboV from Guinea pig Reference DNA Sample            mRNA           Protein

A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.