sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence  5’-TAT-GGC-ATG-3’?       Ile-Arg-Pro     His-Ala-Ile     Tyr-Gly-Met     Val-Arg-Tyr     Ile-Pro-Tyr

Complete the box below:     Convert the following template strand of DNA bases into its complementary mRNA molecule.  Next translate the DNA into a polypeptide chain of amino acids using the Table above. CAATATGGAAGCCGACTCACCCTAATT

draw the structure of the polynucleotide GT

TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this plece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids, Use the abbrevlation of the amino adid exactly as Itswritten in the table (including the appropriate capltalizations For example it your answer for amino acid 1 is"Methionine" you would write MET in the box (not Met or met) Second Later UUU UUUC Phe UCU UAU Ser UAC UAA UAG Tyr UGU Cys U Leu UCA ucG UGC Stop uGA Beop UUG Step UGG Trp G Cuu C cuC CUA CUG CU Leu Coc CCA CG CAU Pro cGu CAC CAA CAG His CGC Arg CGA CGG 1st 3rd letter AUU A AUG AUA AUG ACU le AAU AAC AGU ACC Asn Ser U leBer ACC ACA Mct ACG The AAA AAG ACA Lys AGG Arg acu Val GCC GCA GCG GAU GAC GAA GAG GOU GGC GGA GGG Arp G GUC GUA GUG Ala Gly Glu Seovence of the protein, 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid Sth amino acid: 6th amino acid: 7th amino…

Transcribe the following strand in Mrna, then translate it into amino acids

Give typing answer with explanation and conclusion The following gene codes for a liver enzyme. Changing the A/T base pair to which of the following would result in a missense mutation? 5’ GCCTAATATGCCCGTATGC(AGC)nCGAATAAAATAGTACGGTCGTCGC 3’ 3’ CGGATTATACGGGCATACG(TCG)nGCTTATTTT ATCATGCCAGCAGCG5’ A. C/G B. T/A C. G/C D. Any of the above E. 2 of the above F. None of the above

Give only typing answer with explanation and conclusion

Suppose that a protein has the amino acid sequence Met‑Tyr‑Asn‑Val‑Arg‑Val‑Tyr‑Lys‑Ala‑Lys‑Trp‑Leu‑Ile‑His‑Thr‑Pro A researcher plans to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Her probes should be exactly 18 nucleotides in length. Consult the codon table. Select which amino acids in the protein should be used to minimize degeneracy when designing the probes. Val‑Tyr‑Lys‑Ala‑Lys‑Trp Met‑Tyr‑Asn‑Val‑Arg‑Val Arg‑Val‑Tyr‑Lys‑Ala‑Ly Trp‑Leu‑Ile‑His‑Thr‑Pro Calculate the number of different probes that must be synthesized in order to determine the exact cDNA sequence that specifies the region of the protein selected. number of probes:

Which primer would bind to this coding strand as a reverse primer? 5'- ATGGCCAAAT GATTCCCACG ATTTGGCCAT TGAGATCCGG - 3' O3'- ATGGCCAAAT - 5' O 5'- CCGGATCTCA - 3' O 5'- ATGCGCAGAT - 3' O3'- CCGGATCTCA - 5' N

Give only typing answer with explanation and conclusion  which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template?   5'- CTGTATCCTAGCACCCAAATCGCAT - 3';   A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3',   B. 5' - AUG CGA UUU GGG UGC UAG - 3',   C. 5' - AUG CGA UUU GGG UGC - 3',   D. 5- ATG CGA TTT GGG TCG TAG - 3'