Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a nonsense mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5`- AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-GGC-GGA-AAA-UUU-UAA-3` Write down the tRNA anticodon responsible for adding the last amino acid?

Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a nonsense mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5`- AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-GGC-GGA-AAA-UUU-UAA-3` Write down the tRNA anticodon responsible for adding the last amino acid?

Name: Geneticists are studying a malfunctioning protein that causes impaired
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is iso

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Help me please
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′
The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY