Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3 NH3+- Met-Leu-Phe-Val- COO- NH3+- Met-Thr-Val-Ser- COO- NH3+- Met-Glu-Gln-Ser- COO- NH3+- Met-Asp-Ser-Pro- COO- NH3+- Met-Lys-Phe-Leu- COO-
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…
Q: UAA is a stop codon. Why does the UAA sequence in the segment of mRNA…
A: Stop codons do not specify any amino acid. When ribosome faces any stop codon, it stalls. When the…
Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…
A: The introns are the non-coding parts of the premature mRNA that must be removed by…
Q: During the termination of translation, what is the correct polypeptide sequence which will be…
A: DNA is the storehouse of genetic information. This information age expect by the formation of an…
Q: Demonstrate the consequence on following translation of the insertion of an adenine base to the…
A:
Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…
A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…
Q: Which amino acid sequence will be generated during translation from the following small mRNA:…
A: According to the hint given then the start codon is AUG (Met) The stop codon is UGA .
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The central dogma of life can be stated as follows: Replication of DNA to form new copies of DNA…
Q: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of cell.
Q: The coding strand has the following sequence. Please answer the questions below with regard to this…
A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…
Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…
A: Polypeptides are amino acid chains that forms the various protein molecues in our body. These…
Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?
A: Introduction :- In molecular biology , different processes of gene expression is studied , these…
Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…
A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…
Q: ollowing is the sequence of a segment of mRNA: CGA AAA GUU UUU What are the anticodons of the…
A: mRNA is the polymer of nucleotides formed by the process of transcription using the DNA template…
Q: Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this…
A: Translation occurs when the mRNA gets attached to the ribosome and subunits and the initiation…
Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3
A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…
Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…
A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…
Q: How long is the polypeptide produced from the following mRNA transcript?…
A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…
Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…
Q: Which amino acid would bind if the mRNA read.... AGG? Ala (A) Ser (S) G A Lys (K) Asp (D) U ← Asn…
A: Once mRNA is produced, by transcribing and processing the information contained in the nucleotide…
Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…
A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…
Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…
A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.
Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…
A: Hello! Since you have posted multiple questions, we are answering only first three questions. If you…
Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: if the following DNA sequence were transcribed, which of the following describes the output of this…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…
Q: AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3'…
A: The production of peptide chain or protein from the mRNA is known as translation that occurs within…
Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…
A: Translation Process by which the mRNA codes for a particular protein is known as translation.
Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…
A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…
Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…
A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA
Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid…
A: We'll answer the first question since the exact one is not specified. Please submit a new question…
Q: I only need letter D and E
A: There is a group of three bases in an mRNA. This group of three bases comprises a codon. Each codon…
Q: A protein has the following amino acid sequence:…
A: Given: In the given question stem, sequence of amino acid is given and we have to make set of probes…
Q: ook at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the…
A: Note- According to the guidelines, only the first three questions can be answered out of MCQs.…
Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…
A:
Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'
A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' As following the rules in Genetic code the…
Q: Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A.…
A: The RNA molecule is made up of four nucleotide bases: adenine (A), cytosine (C), guanine (G), and…
Q: The first MRNA codon to specify an amino acid is always Phe Leu (F) (L) Glu Asp (E) (D) Ser (S) Tyr…
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: A template strand of DNA in a gene reads: CCA AGC TCT. Using the codon chart provided, what is the…
A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from ts…
A: INTRODUCTION Amino acids are the building blocks of proteins and nitrogenous backbones of…
Q: Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this…
A: Messenger (mRNA) ribonucleic acid helps in the formation of protein as it contains the long base…
Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: What is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A.…
A: Introduction: Amino acids are biomolecules that contain two functional groups that are amine and…
Q: Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the…
A: Messenger RNA (mRNA) acts as the template for protein synthesis. Though mRNA is associated with…
Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…
A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…
Q: A protein has the following amino acid sequence:…
A: Amino acids- Amino acids are organic compounds that combine to form proteins. Amino acids and…
Q: Using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: Proteins are the building blocks of the body. Proteins are made up of amino acids. All the…
Q: Which of the following mRNA codons signals the start of translation in eukaryotic cells? 5’-UGA-3’…
A: There are 3 stop codons: UAG(Amber) UAA(ochre) UGA(umber) These codons signal the termination of…
Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…
A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…
Translate the following mRNA:
5-A U G A A A U U U C U U U A G G U C G A A -3
NH3+- Met-Leu-Phe-Val- COO- |
NH3+- Met-Thr-Val-Ser- COO- |
NH3+- Met-Glu-Gln-Ser- COO- |
NH3+- Met-Asp-Ser-Pro- COO- |
NH3+- Met-Lys-Phe-Leu- COO- |
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterUsing the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu synthetase, how will the following peptide sequence change upon mRNA translation? wild-type: Met-Lys-Leu-Pro-Ala-Leu-Val-Val-Ala O Met-Lys-Leu-Pro-Ala-Leu-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Val-Val-Alaw/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
- Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?