Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of its protein product? 5'-AUGUGUUGAUGUAUCAGACCUGUC ---
Q: The quality problem A central theme in biochemistry is that protein function is determined by prote...
A: Proteins have four levels of conformation. They are, the primary structure, secondary structure, ter...
Q: 1a-Membrane bound proteins often contain transmembrane domains. These transmembrane domains cont...
A: Membrane proteins can be of three major types- membrane bound/integral, peripheral and lipid anchore...
Q: What risks are involved in genetic engineering of crop plants? How do these risks compare with other...
A: Genetic engineering is a technique where the genes are edited or newly genes are inserted using gene...
Q: State the differences between "planar" and "column" stationary phases and provide examples of each.
A: Chromatography techniques are based on the stationary phases used in separation.
Q: How do you prepare 42:1 chloroform/isoamyl alcohol 70% ethanol?
A: Preparation of 42:1 Chloroform / Isoamyl alcohol Add 42ml of Chloroform and later add 1ml of Isoamy...
Q: What is the difference between symptom and sign. Give examples of symptoms and signs
A: Signs are something that physicians and other people notice it. Symptoms are something that patients...
Q: Q30. During passage through the G1/S transition, the phosphatase that removes the Tyr15 phosphate fr...
A: Cyclin dependent kinases (CDKs) are enzymes which belongs to the family of protein kinases and invol...
Q: Complete the procedure for the synthesis of aspirin by providing the answer to the blanks. In a 125-...
A: In folk medicines and over history people have used many compounds extracted from nature to cure var...
Q: Dexaclomycin is an antibiotic that inhibits peptidoglycan formation. Given this information, what ty...
A: Gram-negative bacteria are surrounded by a thin peptidoglycan cell wall, and an outer cell membrane ...
Q: You characterise a ribosome from a previously unknown organism and determine that it has a 50S large...
A: All prokaryotes have 70S (where S=Svedberg units) ribosomes while eukaryotes contain larger 80S ribo...
Q: What are the different types of solutions according to their concentration? What is its effect of ea...
A: Solutions: A solution is a homogenous mixture that contains a similar kind of substance (solute) di...
Q: Explain the single nucleotide polymorphisms (SNPS) application in medical industries and analyze why...
A: SNP's are point mutations that change the identity of the genetic content by a single nucleotide. Fo...
Q: Each of the following statements concerning mitochondria is true, EXCEPT a.The mitochondria require...
A:
Q: What advantage do alternative sigma factors have for bacterial gene expression?
A: Sigma factors are dissociable subunits of prokaryotic RNA polymerase that are required for its funct...
Q: Which subunit of bacterial RNA polymerase interacts with the -10 region of the promoter?
A: There are two questions on Transcription.
Q: You perform a Bradford assay. You obtain the absorbance values listed below from the BSA samples; yo...
A: Protein quantitation is very important process before processing protein samples for further experim...
Q: Why are some pathogens more noticeable than others?
A: A pathogen is an organism that causes disease in its host, with virulence referring to the intensity...
Q: Step3: After you have prepared the 3 diluted plasmid samples and the master mix, you can now use the...
A: Polymerase chain reaction (PCR) is a technique used to "amplify" or produce more copies of small seg...
Q: 21. Which enzyme is capable of transporting phosphate in a glycolytic pathway? B. isomerase A. dehyd...
A: Hexokinases are enzymes with broad specificity that catalyzes the phosphorylation of six-carbon suga...
Q: importance in familiarizing and knowing the uses of common laboratory
A: The question is all about the knowledge and familiarity of common laboratory equipments that is used...
Q: a. What is the efficiency of the metabolic conversion of palmitic acid to ATP? b. Compute the numbe...
A: Saturated fatty acids include palmitic acid. It has a lengthy chain since the backbone is made up of...
Q: Name some techniques/approaches (name, describe the major steps, how to analyze/interpret results) ...
A: Proteins: Proteins are polymers that contain hundreds or even thousands of amino acids that are lin...
Q: In the figures of ferricrocin and enterobactin, circle the parts of the molecule that are b) respons...
A: Ferricroxin ,is a siderophore involved in intra and transcellular iron transporter in Aspergillus fu...
Q: Based
A: Insulin binds to the receptor activates several cascade of events.
Q: Do glycolic acid and lactic acid belong to the same homologous series? Give a reason for your answer...
A: Homologous series is a series of chemical compounds having similar chemical properties and some of t...
Q: Why did Okazaki propose that lagging strand synthesis proceeds through the synthesis of short fragme...
A: The effective copying of double-stranded chromosomal DNA is required for cellular DNA replication. T...
Q: 2. Circle & Name functional groups C-C-N но H. CH2 CH H,c CH3 HICI
A: The structure given is of the amino acid valine. Valine is a non-polar aliphatic amino acid. Functio...
Q: Answer the following: This type of lipid is a complex mixture of esters of long-chain carboxylic ac...
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other element...
Q: To which class of enzymes does each of the following belong?
A: Enzyme classification in needed to name the enzymes. According to the Enzyme Commission there are si...
Q: Which amino alcohol is used in the synthesis of sphingomyelin?
A: Sphingosine is an 18-carbon amino alcohol with an unsaturated hydrocarbon chain. Sphingomyelin is a ...
Q: Consider the following reaction at 25°C with the ΔG°’ = +1800 J/mol for the forward reaction. The mo...
A: Given Values: ∆G° = 1800 J/mol[A] = 16 mM[B] = 13 mMR = 8.315 J/mol-KT = 25+273 = 298 K
Q: Why do you think DNA is the genetic material used by eukaryotes instead of RNA?
A: Deoxyribonucleic acid (DNA): Nucleic acids are molecules that store hereditary information for perf...
Q: Explain the importance of buffers and what are the main buffers in the body?
A: Almost all the biological processes are pH-dependent. A small change in the pH creates a drastic cha...
Q: The conversion of succinate to fumarate in the TCA cycle is shown below. Need carbon a and b ans...
A: The series of chemical reactions that occur inside the living body for the production of energy are ...
Q: discuss the implications of having a good culture medium for the diagnosis of plant diseases?
A: Plant diseases are caused by different reasons ranging from pest infestations till waterlogged roots...
Q: Is the H+/sucrose cotransport system involved in passive or active transport? How do you know?
A: Secondary active transport is the transport in which the electrochemical gradient that is generated ...
Q: Now imagine that only the Cu center was replaced by Zn(II). What would you expect to happen to the c...
A: c) Cytochromes are heme protein which contains two hemes, a cytochrome a and cytochrome a3, and two ...
Q: Draw the Haworth projection of β-D-Altopyranose given the structure of D-Altrose.
A: Altrose is an aldohexose. Altrose is a C-3 epimer of mannose. The Fischer projection shows the open ...
Q: What are the concepts of specificity, competition, and saturation as they relate to enzymes. Include...
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy....
Q: The Gibbs free energy can be defined as the maximum amount of non-expansion work performed by a clos...
A:
Q: 22. A mutant algae has some of its mitochondria missing with inner mitochondrial membrane. Which of ...
A: The inner mitochondrial membrane is the mitochondrial membrane separating the mitochondrial matrix f...
Q: Explain how PEMBA is used to isolate, differentiate and enumerate Bacillus cereus from food sample.
A: Microscopic organisms such as bacteria, fungi (mold and yeast), protists, archaea, alga...
Q: When a protein denatures in a cell, it tends to assemble into aggregates. Propose an explanation for...
A: Proteins have distinct structures. If they are exposed to specific conditions, they may lose their s...
Q: What group is added to modify methionine on the initiator tRNA in bacteria O phenyl O formyl O methy...
A: Initiator tRNAs (tRNAi) transport methionine (or its product, formyl-methionine) to ribosomes, where...
Q: LUT3 iš homologous to human GLU 25. Rabbi threonine, two (2) serine and one (1) asparagine. Based on...
A: Since the environment within the lipid bilayer is nonpolar, the transmembrane regions of the the mem...
Q: fof NH HO-P-O-P-O-F `NH2 ÓH ÓH OH OH OH Which nucleotide is shown in the picture above?
A: A nucleotide is an organic molecule containing a nucleoside and a phosphate. It is the basic buildin...
Q: pH of MILK is Select one: a. 6.8 b. 8.6 c. 7.5 d. 7.4
A: The milk is nutrient rich and it contains proteins, carbohydrates, fat, and nutrients like Ca. The c...
Q: Which of the following is true of DNA and RNA? both are found in the chromosomes neither DNA n...
A: DNA is the genetic material in an prokaryotic and eukaryotic cell.
Q: What will be the color of saliva extraction with iodine in 3, 6 9, 12, 15, and 18 mins if: you put 5...
A: Carbohydrates are divided into 3 classes monosaccharide, disaccharide, and polysacchari...
Q: does decreasing 2,3-BPG concentration increase or decrease the binding affinity of hemoglobin for ox...
A: 2,3-BPG - 2,3-bisphosphoglycerate Hemoglobin exist in 2 states: T-state (tense), and the R-state (r...
Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of its protein product?
5'-AUGUGUUGAUGUAUCAGACCUGUC ---
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
- Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequenceIndicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
- An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’This question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
- For the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA First position U C A UUU UUC UUA UUG CUU CUC CUA CUG U >Phe GUU GUC GUA GUG >Leu >Leu AUU ACU AUC lle ACC AUA ACA AUG Met/start ACG >Val UCU UCC UCA UCG ©2019 Pearson Education, Inc. CCU CCC CCA CCG GCU GCC GCA GCG Second position A >Ser >Pro Thr >Ala UAU UGU U UAC UGC C UAA Stop UGA Stop A UAG Stop UGG Trp G CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr >His >Gin >Asn >Lys >Asp >Glu CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG >Cys Arg >Ser >Arg >Gly DOAG SCAG U с А UCA с А G Third position Correct answer not given Met-Val-Tyr-Pro Met-His-Phe-Ala-Arg Pro-Val-Met-Leu-His Met-Pro-Val-GluHow many different mRNA sequences can encode a polypeptide chain with the amino acid sequence Met-Leu-Arg? (Be sure to include the stop codon.)Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
