Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why is it sometimes claimed that alternative splicing of exons from a single gene results in a set of proteins of related function?

Q: Yeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes…

A: Tranafer RNA helps in transporting amino acid as per the instructions given by messenger RNA during…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: Suppose that the diagram below represents the genomic organization of an enzyme involved in eye…

A: Transcription is the process by which  RNA transcript is formed from DNA. Various type of RNA are…

Q: Using a table that shows which codon represents which amino acid determine the following:   A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…

A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…

Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…

A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…

Q: Some DNA nucleotides are located within the coding regions of genes, where they specify the amino…

A: When transcription activator proteins bind to the regulatory promoter sequences of gene, they…

Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…

A: Option b

Q: Which of the following introns have self-splicing activity?a) Group I and group IIb) Group II and…

A: An intron is a nucleotide sequence present within a gene which is removed by RNA splicing before…

Q: Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the…

A: Gene is a sequence of nucleotides that encode a particular protein. The transcription and…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a…

A: tRNA (transfer RNA) is a type of RNA that helps decode the genetic information in mRNA to build…

Q: ) The deacetylation of histones generally causes gene inactivation. True or false?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Define FOUR (4) types of point mutations within coding sequences

A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In genes  there are two type of sequence in eukaryotic organisms. one is responsible for formation…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: Indicate whether there is matching (1) or base complementarity (2) between the following nucleic…

A: The template strand is also called antisense strand.  Biosynthesis of mRNA using antisense strand of…

Q: A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species…

A: Trinitrotoluene (TNT), a solid organic nitrogen chemical that is mostly utilised as an explosive and…

Q: Which of the following statements about a transversion mutation in the sequence AGC is true?

A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…

Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…

A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…

Q: Do you think that the alternate splicing of exons may enable a structural gene to code for several…

A: Alternative splicing is a basic regulatory process of gene expression. This process is very…

Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…

A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…

A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In case of eukaryotic organisms after transcription premature mRNA is produced from the DNA (gene).…

Q: Codons 24 to 66 represent an intron.  At what point in the process of protein synthesis are introns…

A: Transcribing DNA to RNA is the initial step in a long process that finally synthesizes functional…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: The characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the…

A: Introduction Transcription takes place in the nucleus, During transcription, It uses DNA as a…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In eukaryotes, RNA transcription differs in comparison to the prokaryotes in terms of RNA splicing.…

Q: This sequence given is of one strand of eukaryotic DNA containing a hypothetical gene. The base that…

A: Answer :  DNA---> mRNA ----------> PROTIENS (AMINO ACIDS)  A=T, G=C(DNA), A = U(mRNA) From…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.