Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why is it sometimes claimed that alternative splicing of exons from a single gene results in a set of proteins of related function?

Q: Yeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes…

A: Tranafer RNA helps in transporting amino acid as per the instructions given by messenger RNA during…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: Suppose that the diagram below represents the genomic organization of an enzyme involved in eye…

A: Transcription is the process by which  RNA transcript is formed from DNA. Various type of RNA are…

Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…

A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…

Q: Yeast have 8 similar tRNA genes with the anticodon 5'-GUA. A researcher mutates one of these genes…

A: Original Codon Decoded: The complementary codon to the anticodon was first decoded by the tRNA…

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…

A: Option b

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Describe the structure of the stomach.

A: The stomach is a J-shaped organ that is present below the diaphragm on the left side of the body. It…

Q: You are working in a research lab that is surveying the CFTR gene sequence in humans to identify new…

A: A synonymous mutation is mutation in the DNA sequence that leads to change in the codon for amino…

Q: Define FOUR (4) types of point mutations within coding sequences

A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In genes  there are two type of sequence in eukaryotic organisms. one is responsible for formation…

Q: You’re going for a bike ride, and as your muscles work harder, your body needs to produce more of…

A: Genes are specific sequences in DNA that code for specific protien required for cell functioning.…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: Consider a single base insertion mutation between the 3rd and 4th codons in a natural gene that…

A: Amino acid  The building blocks of proteins. The protein is a polymer made up of chain of amino…

Q: Indicate whether there is matching (1) or base complementarity (2) between the following nucleic…

A: The template strand is also called antisense strand.  Biosynthesis of mRNA using antisense strand of…

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Alternative splicing is a process that enables a messenger RNA to direct the synthesis of different…

Q: A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species…

A: Trinitrotoluene (TNT), a solid organic nitrogen chemical that is mostly utilised as an explosive and…

Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…

A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…

Q: When scientists cut a eukaryotic gene from genomic DNA, they discovered that enabling the strands to…

A: Alternative splicing is a method through which a messenger RNA may control the creation of many…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…

A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: Exons are the coding sequences that is they code for a specific functional product either in the…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In case of eukaryotic organisms after transcription premature mRNA is produced from the DNA (gene).…

Q: Codons 24 to 66 represent an intron.  At what point in the process of protein synthesis are introns…

A: Transcribing DNA to RNA is the initial step in a long process that finally synthesizes functional…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label…

A: The process by which the mRNA is transcribed from the parental DNA is known as the process of…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In eukaryotes, RNA transcription differs in comparison to the prokaryotes in terms of RNA splicing.…

Q: This sequence given is of one strand of eukaryotic DNA containing a hypothetical gene. The base that…

A: Answer :  DNA---> mRNA ----------> PROTIENS (AMINO ACIDS)  A=T, G=C(DNA), A = U(mRNA) From…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: DNA is double-stranded, but only one strand serves as a template for transcription at any given…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.