If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation causes a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Q: Which amino acid(s) have the most codons? Which amino acid(s) have the fewest codons? Can you think…
A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…
Q: Why will a mistake in the RNA code alone not become a mutation?
A: A change in the genetic code is called a mutation when it becomes a permanent part of the genome of…
Q: Why might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal…
A: Mutation It is the sudden heritable changes happening in the genotype of the organism which is…
Q: You suspect a protein that is being expressed has been affected by a mutation. When you examine the…
A: mutations in the DNA sequences is of many type and can effect the sequence of transcribed mRNA and…
Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…
A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.
Q: What amino acid sequence is coded by the following mRNA base sequence?
A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: What is point mutation? Explain with an example?
A: Mutation can be defined as the slight change or alteration in the nucleotide sequence of the genome…
Q: How might a single base pair difference about 100 bases before the start codon of a gene cause a…
A: The first codon of the mRNA (messenger ribonucleic acid) translated by the ribosome is called the…
Q: the sequences od tRNA and corresponding mRNA is complementary to each other. is the statement true…
A: The synthesis of a functional protein involves two processes namely transcription and translation.…
Q: How would a substitution mutation in the third nucleotide position of the codons for alanine and…
A: A substitution mutation occurs when the specific bases (A,T,C or G) in a gene are swapped for…
Q: Suppose a gene has the sequence ATGGGTTATCGCGAGTAC. A point mutation changes the gene to read…
A: Gene is a segment of DNA that codes for a protein. It transcribes to mRNA which then translates to…
Q: How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences…
A: The genetic information flows from the form of DNA into the form of protein and this framework is…
Q: The anticodon 3’-CUG-5’ can base pair with which codon in mRNA?
A: Introduction :- A trinucleotide sequence at one end of a transfer RNA (tRNA) molecule that is…
Q: transcription and translation. What
A: Transcription is the process of copying a gene's DNA sequence to make an RNA molecule and…
Q: 1. DNA Sequence: TẠC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT…
A: As per our guidelines, we are supposed to answer only one question. Please repost other question in…
Q: What is the minimum number of tRNA molecules that a cell must contain in order to translate all 61…
A: A transfer RNA is adaptor molecule composed of RNA having 76 to 90 nucleotides in length.
Q: A substitution mutation that results in the formation of a stop codon and premature termination of…
A: Mutations are the alterations or the change that occur in the DNA. Mutagens, like ultraviolet…
Q: . What mRNA base sequence would be obtained from the following portion of a gene?
A: Genetic information is transferred from genes to the proteins via messenger RNA.…
Q: A point mutation occurs in the middle of the coding sequence for agene. Which types of…
A: Mutation is the process of abrupt changes in the nucleotide sequence or gene in the DNA. Mutation…
Q: Which type of mutation stops the translation of the mRNA?
A: If a point mutation changes the amino acid to a “stop,” it's called a NONSENSE mutation
Q: If the regulatory gene on DNA suffered a mutation in which produced nonfunctional proteins, which of…
A: In a operon regulatory genes codes for repressor protein.
Q: name one kind of mutation that produces an altered protein. what determines wether the altered…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: Why do some genetic mutations lead to completely nonfunctional proteins while others do not affect…
A: A mutation is a sudden change in the sequence of DNA. DNA is made up of nucleotides. DNA is…
Q: In how many cases in the genetic code would it NOT be possible to know the amino acid specified by a…
A: DNA or deoxyribonucleic acid is a double-helical molecule consisting of two polynucleotide chains.…
Q: What is the anticodon that would pair up with the MRNA codon UAG? In What part of the cell is…
A: The central dogma of molecular biology includes replication, transcription and translation. Between…
Q: Does a mutation always result in a change of an amino acid sequence in protein? Why?
A: A mutation is the alteration of the nucleotide sequence of the genome which may or may not result in…
Q: The amino acid sequence for a short peptide is Tyr-Leu-Thr-Ala. What are the possible base sequences…
A: Gene expression is the process by which information from a gene is used for synthesizing of a…
Q: If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the protein…
A: Mutations are the changes in the genes of the cell that causes abnormalities in the structure and…
Q: What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?
A: The sequence of a protein is notated as a string of letters, according to the order of the amino…
Q: What might be the result of a mutation of DNA in which a triplet code such as UAC now says UAA in…
A: Mutation is the change in the DNA which may cause the change in the amino acid of the protein.…
Q: How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce?
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Q: How many nucleotides would be carried on a strip of mRNA with 10 codons?
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: why is it important that unprocessed mrna never leaves the nucleus?
A: Transcription is the process by which genetic information present in a DNA sequence is copied into…
Q: If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed
A: If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed?…
Q: The structural portion of genes contains two distinct types of regions—exons and introns. Which…
A: Introns and exons are nucleotide sequences inside a gene. They both are distinct regions of the…
Q: . What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61…
A: The three consecutive nucleotides on messenger ribonucleic acid from codon. The codon sequence…
Q: What protein sequence would a cell make from the following mRNA? 5'- CCAUGCACCAAUAGAUAACCG-3' O PCTN…
A: During the translation, the sequence of nucleotides in the mRNA is translated into a sequence of…
Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: What would be the effect of a mutation that causes a poly(A)-binding protein to be nonfunctional?
A: Poly(A)-binding protein (PABP) is a RNA binding protein, which helps the polyadenylate polymerase…
Q: Which class of mutation, missense or nonsense, is morecommon, and why?
A: Nonsense Mutation when there occurs deletion or insertion of single nucleotide base in the gene then…
Q: What characteristic of the genetic code explains why a substitution mutation in a codon contained…
A: Codons are sets of three nucleotides responsible for the detection by tRNA for the type of amino…
Q: Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of…
A: It is one of the types of mutations subclassified on the basis of the effects on the function of…
Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…
A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…
Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…
A: The proteins are the fundamental biomolecules in the body and act as substrates, enzymes, and…
Q: Which amino acid is at the beginning of every eukaryotic protein and why?
A: The genetic information is transferred from DNA to RNA and from RNA to protein. This flow of genetic…
Q: What are the key properties of the genetic code? Given that the genomes of all organisms are made up…
A: Genetic code is the sequence of nucleotides in DNA or RNA which determines the sequence of amino…
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation causes a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…
- Which of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?
- Help me pleaseAs described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′The amino acid sequence for a short peptide is Tyr-Leu-Thr-Ala. What are the possible base sequences of the mRNA and the transcribed DNA strand that code for it? What are the anticodons?
- Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the protein remains functionally the same; which of the following would best describe the result of this mutation? 1) frameshift mutation. O 2) insertion mutation. O 3) silent mutation. 4) nonsense mutation. O 5) back mutation.Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?