Gene sites sensitive to mutation DNA Components of protein active site Promoter Intron 3' Wild type Exon Exon m1: null m2: null m3: null m4: leaky m5: silent m6: null m2 Active site FIGURE 2-13 Mutations in the parts of a gene encoding enzyme active sites lead to enzymes that do not function (null mutations). Mutations elsewhere in the gene may have no effect on enzyme function (silent mutations). Promoters are sites important in transition initiation. Protein m4 m5 m3 = mutant site

Gene sites sensitive to mutation DNA Components of protein active site Promoter Intron 3' Wild type Exon Exon m1: null m2: null m3: null m4: leaky m5: silent m6: null m2 Active site FIGURE 2-13 Mutations in the parts of a gene encoding enzyme active sites lead to enzymes that do not function (null mutations). Mutations elsewhere in the gene may have no effect on enzyme function (silent mutations). Promoters are sites important in transition initiation. Protein m4 m5 m3 = mutant site

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 9P

See similar textbooks

Similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Cytosine deaminationoccurs ~100 cytosinesper genome per day in a human genome. Eukaryotic cells also contain residues of 5’-methylcytosine, which is involved in regulating gene transcription rates. Mutation of 5’-methylcytosine by deaminationconverts it to thymine. This presents the cell with a much more severe problem than normal cytosine deaminationof cytosine to uracil. Why?
. Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some ofthese mutant proteins are of normal size (but haveamino acid substitutions) while others are short, dueto deletions or nonsense mutations. The first extralong example was named Hb Constant Spring, inwhich the β-globin has all of its normal amino acidsplus several extra amino acids attached after thenormal C-terminal end of the protein. a. What is the most plausible explanation forits origin?b. Is it possible that Hb Constant Spring arose fromfailure to splice out an intron?c. Estimate how many extra amino acids mightbe added to the C terminal end of the mutantprotein
DNA Protein Wild-type Gene GCC GAA AGC... Ala Ala CH₂ Glu Ser GM Functional enzyme What is the subject of the figure HO-Ser Catalytic site What is the main message of the figure? Mutant Gene OCC AA AGC... Ala Ala-CH₂ Single nucleotide change Give a concise, complete and specific explanation of the heuret happening at DNA, protein and enzyme layers shown Lys Se 199 NH, HOSer Defective enzyme -Explain what is
Mutations/deficiencies in protein components of the ECM, CAMS, and cell junctions are involved in the expression of some human diseases. List and describe these pathologies in the table below. An example is given in the fırst row. Name of disease Symptoms Molecular Basis of Disease Severe vitamin C deficiency is caused by ascorbic acids' role in collagen synthesis. Vitamin C allows Anemia, debility, exhaustion, spontaneous hydroxylation and crosslinking of pro-collagen bleeding, pain in the limbs, and especially catalyzed by lysyl hydroxylase. Lack of vitamin C decreases transcription of pro-collagen. Additionally, a lack of ascorbic acid leads to epigenetic DNA hypermethylation and inhibits the transcription of various types of collagen found in skin, blood vessels, the legs, swelling in some parts of the body, and sometimes ulceration of the gums and loss of teeth Scurvy and tissue. 1 2 3 5 4.
A Leu →Ala mutation at a site buried in the core of the enzyme lysozymeis found to be destabilizing. Explain the observed effect of this mutationon lysozyme stability by predicting how enthalpy (ΔH°), conformationalentropy (ΔS°peptide), and the hydrophobic effect (ΔS°solvent) are expected to change for the mutant compared to wild-type lysozyme. Explain how ΔG°for unfolding is affected by your predicted changes in enthalpy or entropy.
Sickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.
Development of the nematode Caenorhabditis ele-gans generates exactly 959 somatic cells; it also producesan additional 131 cells that are later eliminated by apop-tosis. Classical genetic experiments in C. elegans isolatedmutants that led to the identification of the first genesinvolved in apoptosis. Of the many mutations affectingapoptosis in the nematode, none have ever been found inthe gene for cytochrome c. Why do you suppose that sucha central effector molecule in apoptosis was not found inthe many genetic screens for “death” genes that have beencarried out in C. elegans?
The intermediates A, B, C, D, E, and F all occur inthe same biochemical pathway. G is the product of thepathway, and mutants 1 through 7 are all G−, meaningthat they cannot produce substance G. The followingtable shows which intermediates will promote growthin each of the mutants. Arrange the intermediates inorder of their occurrence in the pathway, and indicatethe step in the pathway at which each mutant strain isblocked. A + in the table indicates that the strain willgrow if given that substance, an O means lack of growth.SupplementsMutant A B C D E F G1 + + + + + O +2 O O O O O O +3 O + + O + O +4 O + O O + O +5 + + + O + O +6 + + + + + + +7 O O O O + O +
What is the possible consequence(s) of a Q188R mutation for the function of the protein? Keeping Galactosemia in mind for the answer.
АСTIVITY For each of the 4 regulatory states of the lac shown in the following diagram, answer the following questions: оperon 1) Is glucose present? 2) Is lactose present? Synthesis of lac MRNA? Glucose present? Lactose present? NO Repressor y a NO CAMP-CRP complex y YES Transcription i p o y NO
The tumor suppressor pRB also binds to and suppresses theactivity of retinoblastoma binding protein 2 (RBP2), ahistone demethylase that removes methyl groups from diand trimethylated lysines in histone 3. What is the possibleconsequence of an inactivating mutation in RB1 that causesan inability of pRB to bind RBP2?