Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons.

Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons.

Name: Q. Deletion of a single AT base pair from codon number 4 can cause a f
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene.Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
. A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′ ACGATGGAA 5′CodonIf mismatch repair occurs in either direction, whichamino acids could be found at this site?
A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGAGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG- 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may choose than In event, explain choice(s). more one answer. any your I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C>A mutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning. C. Suppose the base at position 70 changes to A (adenine), would this be considered a mutation? In your own words, explain your reasoning.
a. Use the genetic code provided in class to predict the sequence of protein formed from the following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA sequence being read shifts rover by a base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? GCUACAUCUUUA c. If a gene mutation results in a point mutation, meaning a single nucleotide is converted to a different nucleotide base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? CGCUCCAUCUUU d. Which mutation is more likely to result in a slightly altered, but still functional, protein, the frame shift mutation or the point mutation? Briefly explain your answer.
1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.
Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translation
a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Can you be sure?
A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)
. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?
point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三囲 Y pre-MRNA:| I囲2 L
b. Explain how Nirenberg and Leder/Matthaei were able to create many of the codon/amino acids found in the Genetic Code (i.e. what was their experimental set- up, how did they know if the codons matched, what were the knowns, and finally what codons did they struggle with and why).
For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.