Removing introns from pre-mRNA can result in different gene variants”- Briefly explain this statement at your own words.

What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC (assume transcription is from left to right)? Indicate clearly the 5' and 3' ends of your transcript. 5'-GAUGUUUAC-3' 5'CUACAAAUG-3' 5'-CAUUUGUAG-3' 5'GUAAACAUC-3

The first nucleotide in mRNA that will be synthesized from DNA below is:  3'- ACGTATAGCCGGACGTCACTCGCTA-5' 5'-TGCATATCGGCCTGCAGTGAGCGAT-3'

Explain why DNA replication must be primed by RNA.   Explain how splicing happens in 4-5 sentences. Splicing is caused by a complex called spliceosome. This complex removes introns and joins the exons. It is called post transcriptional processing of RNA. (What I have so far) If you can only answer the first question, that is fine! Thank you for your help!

Pick either one of the following to answer: 1) Transcription and translation both involve an initiation, elongation, and termination phase. Describe how each of these phases occurs for both transcription and translation. OR 2) Both transcription and translation involve modifications following the termination step. Describe these modifications and the importance of each modification to complete the final product.

Define both transcription and translation. In addition, describe the role(s) of each of the following in the processes of gene expression and protein synthesis:  DNA, mRNA, tRNA, rRNA, ribosome(s), RNA polymerase, codon, anticodon, amino acid(s) and polypeptide(s). Be detailed in your answer.

What are the “protein synthesis factories?” Give an overview of the relationship between these “factories” and mRNA to explain why they are called the “protein synthesis factories.

This type of mutation, where one nucleotide was replaced for another, is called a point mutation. White skin and blue eyes are examples of point mutations.Provide the mRNA that will be made from the mutated strand : 3' TAATATATCCGTACCGTTTAAAGGGTTACATAATTTTTCATCCCATTA5'