Gene Expresslon O FIGURE 7.10 The Process of RNA Synthesis Bacterial RNA polymerases have a sigma subunit that allows them to recognize a promoter (as illustrated); the RNA polymerases of eukaryotic cells and archaea use Transcription transcription factors to recognize promoters. ? Which component of the bacterial RNA polymerase recognizes the promoter? Translation 5' 3' 3' 5' Promoter Terminator RNA polymerase 1 Initiation RNA polymerase binds to the promoter and melts a short stretch of DNA. 5' 3' 3' 5' Template strand Sigma 2 Elongation Sigma factor dissociates from RNA polymerase, leaving the core enzyme to complete transcription. RNÁ is synthesized in the 5' to 3' direction as the enzyme adds nucleotides to the 3 end of the growing chain. 5' 3' 5' Promoter RNA ETGAS Termination When RNA polymerase encounters a terminator, it falls off the template and releases the newly synthesized RNA. 5' 3' 3" 5' Promoter RNA polymerase dissociates from template.

Gene Expresslon O FIGURE 7.10 The Process of RNA Synthesis Bacterial RNA polymerases have a sigma subunit that allows them to recognize a promoter (as illustrated); the RNA polymerases of eukaryotic cells and archaea use Transcription transcription factors to recognize promoters. ? Which component of the bacterial RNA polymerase recognizes the promoter? Translation 5' 3' 3' 5' Promoter Terminator RNA polymerase 1 Initiation RNA polymerase binds to the promoter and melts a short stretch of DNA. 5' 3' 3' 5' Template strand Sigma 2 Elongation Sigma factor dissociates from RNA polymerase, leaving the core enzyme to complete transcription. RNÁ is synthesized in the 5' to 3' direction as the enzyme adds nucleotides to the 3 end of the growing chain. 5' 3' 5' Promoter RNA ETGAS Termination When RNA polymerase encounters a terminator, it falls off the template and releases the newly synthesized RNA. 5' 3' 3" 5' Promoter RNA polymerase dissociates from template.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 20RQ: A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of...

See similar textbooks

Similar questions

The sigma subunit of bacterial RNA polymerase ________________________. is required for the initiation of transcription binds to the RNA polymerase core enzyme must be released from the RNA polymerase for transcription to enter the elongation phase binds to the bacterial promoter sequence All of the other answers are correct.
What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerase
Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Intron 1 Intron 2 1 100 s100 base pairs 1100 2100 3100 4100 Positions 200-203 = Start codon Positions 4800-4802 = Stop codon Figure 2. (i) The transcript first produced by ABC gene would be approximately how many nucleotides long?
Which of the following characterize RNA polymerase Il transcriptional termination in eukaryotes? Endonuclease cleavage of the RNA transcript and 5' to 3' exonuclease activity a protein known as Ratl None of the provided answers, transcriptional termination occurs in prokaryotes. Recognition of the transcriptional stop codon by a release factor. Hairpin structure formation on the newly synthesized RNA molecule which disrupts the DNA-RNA hybrid at a poly-U RNA sequence Binding of the Rho protein.
5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)
E channel Charged tRNA Anticodon for START Initiating factors Release factors m III III exit site for an uncharged stem of tRNA UAC located on tRNA's anticodon arm proteins that help mRNA bind to a small and large ribosomal subunit to start translation a tRNA that contains its appropriate amino acid attached to the acceptor arm bind to STOP codons and result in a hydrolysis reaction that creates a drop of water that halts translation
Shown below is an eukaryotic gene. Assuming normal wild type RNA processing in a.cell, which of the following mature MRNAS could result in normal levels of functional synthesized proteins? Select all that apply Direction of transcription Promoter Template strand 5' Exon 4 Intron 3 Exon 3 Intron 2 Exon 2 Intron 1 Exon 1 3' 5' Coding strand Transcription start Transcription start 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA...AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4 Exon1-Exon2-Exon3-Exon4-.....AAAA
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?
Savec TRNA function A TRNA molecule is an ncRNA that has which function(s)? Check All That Apply guide template for protein synthesis ribozyme blocker scaffold
Which of the following correctly states a similarity between transcription in prokaryotes and eukaryotes? In both domains of life, RNA polymerase begins and ends transcription at the start and stop codons, respectively. In both domains of life, RNA polymerase reads the template strand from 5' to 3" In both domains of life, RNA polymerase synthesizes new RNA transcripts in the 3-5 direction. In both domains of life. RNA polymerase depends on additional proteins to bind to a promoter and subsequently initiate transcription. OIV. In both domains of life, transcription is independent of cis-acting sequences in the chromosome. V.
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'