Select whether each of the components are associated with eukaryotic or prokaryotic transcription. (When studying for exams, think about what the other component would be!) Prokaryote or Eukaryote?? RNA polymerase + sigma protein:                               TATA box:                                    General/basal transcription factors:                                  Rho-independent/dependent termination:                           [

Indicate which of the following items are associated with transcription or translation.  This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription    Sigma binds to the promoter                                                    mRNA binds to the small ribosomal subunit                                                    Spliceosomes remove introns and splice together exons                                                    Nucleotides are added from the 5' to 3' end                                                    tRNA anticodon binds to the corresponding mRNA codon                                                    STOP codon results in termination

Which of the following most accurately describes the process involved in protein synthesis? Transcription factors activate promoter region -> transcription by mRNA -> translation by ribosomes Translation by ribosomes -> transcription factors activate promoter region -> transcription by mRNA Transcription by mRNA -> transcription factors activate promoter region -> translation by ribosomes Translation by ribosomes -> transcription by mRNA -> transcription factors activate promoter region

In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In your response, include the following: - differences in what structures (DNA, RNA, proteins etc...) are involved - differences in timing and location - DO NOT include any details on what happens after transcription

The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold)

Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you

A cell has a mutated mediator protein. a) How will this affect transcription of genes? (circle an answer below) No transcription Weak transcription will occur   Strong transcription will occur b) Why? Describe your choice above

Match the statement that corresponds to the specific type of transcription and translation. Choices: Eukaryotic Translation Prokaryotic Translation and Transcription Both Prokaryotic and Eukaryotic Transcription Prokaryotic Transcription Prokaryotic Translation Both Prokaryotic and Eukaryotic Translation Eukaryotic Transcription 1. RF1 and RF2 recognize the three bases to terminate the process 2. TATA box in the promoter region 3. single mRNA codes for the proteome 4. methionine is removed 5. simultaneous and rapid process producing mRNA and polypeptide 6. eRF recognizes UGA  7. dozen of initiation factors involving methionyl tRNA * 8. rho factor and sequence of uracil in a loop conclude the process 9. ribosome propels to the next bases  10. sigma factor binds to RNA polymerase in the promoter region 11.  regulating elements in the operon  12. cleaving the polypeptide by adding water 13. removal of gene segment disrupting the message 14. CAAT box is found 80 nucleotides from the…

What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA?  The top strand is the template strand, the bottom strand is the coding strand.     5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’   3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'

Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found in RNA? 2. What bases are found in DNA? 3. Which strand is the messenger RNA complementary to? 4. Which strand is the messenger RNA nearly identical to? 5. What proteins help to direct the RNA Polymerase to the right location? 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish between the following two terms: chromosome and gene. 8. Scientists have long referred to the DNA between genes as "junk DNA". But as scientists study the genome, they discover new and unique reasons why this DNA is not really "junk". Using internet resources, research 2 functions for sections of DNA in between genes. Describe your findings below. C) 2015 Bethany Lau.