the gene where transcription begins, it is said to be at the 5' end of the gene; thus, the promoter region is also called the 5' regulatory region (Figure 8-7a). The first transcribed base is always at the same location, designated the initia- tion site. The promoter is referred to as upstream of the initiation site because it is located ahead of the initiation site (5' of the gene), in the direction opposite the direction of transcription. A downstream site would be located later in the direc- tion of transcription. By convention, the first DNA base to be transcribed is FIGURE 8-6 The MRNA sequence is complementary to the DNA template strand from which it is transcribed and therefore matches the sequence of the nontemplate strand (except that the RNA has U where the DNA has T). This sequence is from the gene for the enzyme B-galactosidase. Sequences of DNA and transcribed RNA Nontemplate strand 5' CTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGATCTGCGCTGC- 3 Coding strand DNA Template strand 3' Noncoding strand GACGGTAACAGTCTGTACATATGGGGCATGCAGAAGGGCTCGCTTTTGCTAGACGCGACG - 5' 5 CUGCCAUUGUCAGACAUGUAUACCCCGUACGUCUUCCCGAGCGAAAACGAUCUGCGCUGC-3' MRNA

the gene where transcription begins, it is said to be at the 5' end of the gene; thus, the promoter region is also called the 5' regulatory region (Figure 8-7a). The first transcribed base is always at the same location, designated the initia- tion site. The promoter is referred to as upstream of the initiation site because it is located ahead of the initiation site (5' of the gene), in the direction opposite the direction of transcription. A downstream site would be located later in the direc- tion of transcription. By convention, the first DNA base to be transcribed is FIGURE 8-6 The MRNA sequence is complementary to the DNA template strand from which it is transcribed and therefore matches the sequence of the nontemplate strand (except that the RNA has U where the DNA has T). This sequence is from the gene for the enzyme B-galactosidase. Sequences of DNA and transcribed RNA Nontemplate strand 5' CTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGATCTGCGCTGC- 3 Coding strand DNA Template strand 3' Noncoding strand GACGGTAACAGTCTGTACATATGGGGCATGCAGAAGGGCTCGCTTTTGCTAGACGCGACG - 5' 5 CUGCCAUUGUCAGACAUGUAUACCCCGUACGUCUUCCCGAGCGAAAACGAUCUGCGCUGC-3' MRNA

Name: In Figure 8-6, describe where the gene promoter islocated. the gene wh
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: In Figure 8-6, describe where the gene promoter islocated. the gene where transcription begins, it is said to be at the 5' end of the gene; thus,the promoter region is also called the 5' regulatory region (Figure 8-7a).The first transcribed base is a

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

Mechanisms that inhibit TE activity include theproduction of transposition repressors throughalternative splicing and the action of _________ thatblock TE transcription.
TRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma o subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. The distal histidine stabilises the iron in heme group of a deoxyhaemoglobin. Receptor for epinephrine consists of seven transmembrane helices. Membrane receptors bind to hydrophobic signaling molecules. Amino acids, glucose and fatty acids are taken up by transporters into liver cells. Glycerol and fatty acids are synthesized from the intermediates of glycolysis. Synthesis of fatty acid occurs in cytoplasm. Triacylglycerol can be obtained from diet and also synthesized in liver cells. Ammonia and keto acid are formed in transamination.
Regarding the trp operon: when levels of tryptophan are low, the ___ hairpin forms, resulting in _____ of transcription. Group of answer choices 2-3; termination 3-4; termination 3-4; continuation 2-3; continuation
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Mark the point at which transcription will terminate
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
Promoters of the INS gene
The Assembly of Class III Transcription Initiation Complexes consists of TATA-binding protein (TBP) TBP-associated factor (TAF) Both None
Which of the following sequences would most likely be the site of the initiation of transcription? ТАТАААТА GCTAGCTA GGCGGCCC Impossible to tell
The basic of transcription include nucleosome remolding, pre-initiation, initiation, promoter clearance and elongation and termination. Describe these steps into detail including basic machinery involved, enzymatic activities and potential aberrancies that increase or decrease gene transcription
"Upstream" "Downstream" Exons Start of transcription Termination codon 5 3' Promoter initiator codon Introns Polyadenylation signal (intervening sequences) 5' untranslated region 3' untranslated region Direction of transcription Please study the diagram above on eukaryotic gene expression. In order to provide instructions for gene expression, a eukaryotic gene should have the following sequences except for O A. Promoter B. Start codon also known as initiator codon C. Splicing signals (dinucleotide sequence in the intron) O D. 5' CAP sequence
In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In your response, include the following: - differences in what structures (DNA, RNA, proteins etc...) are involved - differences in timing and location - DO NOT include any details on what happens after transcription
Give only typing answer with explanation and conclusion