In Figure 8-6, describe where the gene promoter islocated. the gene where transcription begins, it is said to be at the 5' end of the gene; thus,the promoter region is also called the 5' regulatory region (Figure 8-7a).The first transcribed base is always at the same location, designated the initia-tion site. The promoter is referred to as upstream of the initiation site because itis located ahead of the initiation site (5' of the gene), in the direction opposite thedirection of transcription. A downstream site would be located later in the direc-tion of transcription. By convention, the first DNA base to be transcribed isFIGURE 8-6 The MRNA sequence iscomplementary to the DNA templatestrand from which it is transcribed andtherefore matches the sequence of thenontemplate strand (except that the RNAhas U where the DNA has T). Thissequence is from the gene for the enzymeB-galactosidase.Sequences of DNA and transcribed RNANontemplate strand5'CTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGATCTGCGCTGC- 3Coding strandDNATemplate strand3'Noncoding strandGACGGTAACAGTCTGTACATATGGGGCATGCAGAAGGGCTCGCTTTTGCTAGACGCGACG - 5'5CUGCCAUUGUCAGACAUGUAUACCCCGUACGUCUUCCCGAGCGAAAACGAUCUGCGCUGC-3' MRNA

Name: In Figure 8-6, describe where the gene promoter islocated. the gene wh
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: In Figure 8-6, describe where the gene promoter islocated. the gene where transcription begins, it is said to be at the 5' end of the gene; thus,the promoter region is also called the 5' regulatory region (Figure 8-7a).The first transcribed base is a