21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 5' untranslated region 3' untranslated region folding into its functional shape splicing out exons adding a poly-A tail removal of non-coding sections capping the 5' end

10

5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’    Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)

What is the mechanism for addition of a guanosine to create the 5' methyl cap of a mRNA? O The 5'-OH end of the nascent mRNA performs a nucleophilic attack on the gamma phosphate of GTP O The gamma phosphate is removed from the 3' end of the nascent MRNA and then the beta-phosphate attacks the phosphorus atom of the alpha- phosphate of GTP O The gamma phosphate is removed from the 5' end of the nascent mRNA and then the -OH group from the beta-phosphate attacks the phosphorus atom of the alpha- phosphate of GTP O The 5'-OH end of the beta phosphate present on nascent mRNA performs a nucleophilic attack on the alpha-phosphate of GTP

Which subunit of RNA Pol I| functions as an assembly platform and regulator of pre- MRNA processing? Carboxyl terminal domain N-terminal domain minor O All of the above

1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 - AAUAUGCGGAUGCCCGAA -3     4     5     6     7 (b) "In this mutation, the UGG codon is replaced with UGA."     missense mutation     nonsense mutation     silent mutation     frameshift mutation

Number 10) Please put the following steps of eukaryotic protein synthesis in order from first (1) to last (4) _ 5' cap    _ translocation out of nucleus                                                             _ splicing                                                                        _ primary mRNA

There are multiple answer to this question I'm looking for the right ones

1.The Shine Dalgarno sequence is ____________. located in the 50S subunit of ribosome. located on the 16S rRNA component of the 30S subunit of ribosome. a sequence upstream of the AUG initiation codon on mRNA. a DNA consensus sequence in the promoter region of a gene. a signal for transcription termination.

36.Start with two exons and an intervening intron. Include the cap and poly-A tail in your starting pre-mRNA. Show 2’-OH, 3’-OH, O-P-O phosphodiester bonds for the two transesterification reactions that splice exon 1 and exon 2. Be sure to include the branchpoint A and intron consensus sequences. You will need to show where the incoming -OH attacks the O-P-O bond to allow correct splicing in the lariat and between exons. Make your arrows precise. Show the lariat with the consensus sequences. Whenever possible, show 5’ and 3’ ends. Explain the fate of the lariat after it forms?