
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
thumb_up100%

Transcribed Image Text:015347/quizzes/5825797/take
21. The processing events that must occur on the MRNA after it is
transcribed, but before it is released into the nucleus include (select all
that apply)
Primary RNA transcript
Exon 1 Intron Exon 2 Intron Exon 3
RNA processing
Spliced RNA
Exon 1 Exon 2 Exon 3
AAAAAAA
5' cap
Poly-A tail
3' untranslated
region
5' untranslated
region
O folding into its functional shape
O splicing out exons
O adding a poly-A tail
O removal of non-coding sections
O capping the 5' end
hp
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Label if each 0f the fonouing Sequences are present in DNA, pre-RNA andlor MRNA of eukanyotes : Promoter Enhancer 3'UTR Introns - Poly-A - Tail- 5 Cun sensus spiice Site- Start Codon - Cleavage signal sequence –arrow_forward1 You will start with Transcription translation Sequence I. You are allowed two attempts 1 point Assemble the mRNA Transcription translation Sequence I. 546465-33-33-4448538854-266666668885-34-483- If this was an eukaryote, what would you find in the leftmost cytosine? 5' Poly A tail 3' Poly A tail 5' Cap 3' Cap 2 3 $ 4 er dº 5 6 7 8 9 0 + 11 Nearrow_forwardWhat would the sequence of the immature mRNA be? Place the sequence of ALL the transcript that would be synthesized from the gene. In each of the available line you should transcribe all nucleotides that form the immature mRNA. If the sequence indicated is not transcribed then write NA. WRITE THE NUCLEOTIDES IN CAPITAL LETTERS. Promoter: EXON 1: Intron 1: Exon 2: Intron 2: Exon 3 without terminator : Exon 3 terminator:arrow_forward
- 10arrow_forward5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)arrow_forwardWhat is the mechanism for addition of a guanosine to create the 5' methyl cap of a mRNA? O The 5'-OH end of the nascent mRNA performs a nucleophilic attack on the gamma phosphate of GTP O The gamma phosphate is removed from the 3' end of the nascent MRNA and then the beta-phosphate attacks the phosphorus atom of the alpha- phosphate of GTP O The gamma phosphate is removed from the 5' end of the nascent mRNA and then the -OH group from the beta-phosphate attacks the phosphorus atom of the alpha- phosphate of GTP O The 5'-OH end of the beta phosphate present on nascent mRNA performs a nucleophilic attack on the alpha-phosphate of GTParrow_forward
- Which subunit of RNA Pol I| functions as an assembly platform and regulator of pre- MRNA processing? Carboxyl terminal domain N-terminal domain minor O All of the abovearrow_forward1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7 (b) "In this mutation, the UGG codon is replaced with UGA." missense mutation nonsense mutation silent mutation frameshift mutationarrow_forwardNumber 10) Please put the following steps of eukaryotic protein synthesis in order from first (1) to last (4) _ 5' cap _ translocation out of nucleus _ splicing _ primary mRNAarrow_forward
- There are multiple answer to this question I'm looking for the right onesarrow_forward1.The Shine Dalgarno sequence is ____________. located in the 50S subunit of ribosome. located on the 16S rRNA component of the 30S subunit of ribosome. a sequence upstream of the AUG initiation codon on mRNA. a DNA consensus sequence in the promoter region of a gene. a signal for transcription termination.arrow_forward36.Start with two exons and an intervening intron. Include the cap and poly-A tail in your starting pre-mRNA. Show 2’-OH, 3’-OH, O-P-O phosphodiester bonds for the two transesterification reactions that splice exon 1 and exon 2. Be sure to include the branchpoint A and intron consensus sequences. You will need to show where the incoming -OH attacks the O-P-O bond to allow correct splicing in the lariat and between exons. Make your arrows precise. Show the lariat with the consensus sequences. Whenever possible, show 5’ and 3’ ends. Explain the fate of the lariat after it forms?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education