DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC  TCT  GGC TCT  CCA  AGT  TGA  ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids?

Q: Please answer fast Give ans for each statement   1.A protein linked to a disease state is being…

A: A protein cause disease if it misfolded and aggregared even though it has same amino acid…

Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A missense mutation is a type of point mutation where a single nucleotide change in the DNA sequence…

Q: You are interested in the rapid mutation rate of the polymerase of a virus XY, that inserts its…

A: The mutation changes the amino acid at the third position. Specifically, it changed from Glycine…

Q: A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: at is the difference between sickle-cell A sequence and normal DNA sequence? . Normal DNA sequence:…

A: Any abrupt changes in the DNA sequence results in a mutation. This may or may not change the…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

A:

Q: 3' c |c 5' 5' 1 1 1 A T 2 2 2 A C c 3 3 3 G T 4 4 4 A Reference - DMD - Template 5 6 T C c G…

A: Coding strand    Coding strand is-       GGT AAT GGC  AAT  AGA  GGC  CGA  TAC  ACA  GGA patients…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: What happens if you replace the trp codons in the trp leader sequence with codons specifying…

A: If the tryptophan is replaced in the trp codon sequence with codons specifying isoleucine, the cell…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: If the DNA sequence that coded for a codon that was complimentary to the ANTICODON AAU underwent a…

A: A mutation may be a change within the sequence of DNA. Mutations can occur as a result of the term…

Q: 1. DNA Sequence: TẠC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT…

A: As per our guidelines, we are supposed to answer only one question. Please repost other question in…

Q: Which of the following types of point mutations will not produce a change in amino acids and…

A: Answer: MUTATION : It is the change occured in the nucleotides of DNA/genome sequence , this is…

Q: GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH…

A: The template strand extends from 3' to 5'. The coding strand, that extends from 5' to 3' in…

Q: What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription…

A: Elongation Factor Thermo Unstable (EF-Tu) is one of the most prevalent proteins in bacteria, making…

Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…

A: Introduction AUG(Met) GG(U, C, A, G)(Gly) GU(U, C, A, G)(Val) CA(U, C)(His) AU(U, C, A)(Ile) UA(U,…

Q: Describe the mutation that occurs in the following examples (be specific, if possible): BOAT  to BAT…

A: Mutations are changes or alterations or modifications in the nucleotide sequence of the genome or…

Q: Match each example of mutation to the correct effect on function. Hypomorphic mutation Hypermorphic…

A: Introduction  Mutation is a change in the genetic material (DNA) of an organism. It can be a change…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: 7 Pribnow box Sigma factor Hogness box Aminoacyl tRNA synthase Rho factor 8 DNA pol 5 hnRNA RNA pol…

A: Central dogma explains the flow of genetic information in all cells. The three main processes:…

Q: What is the RNA template that comes from it ? 5’-G-C-C-A-T

A: The RNA template is the protein synthesis template or the type of RNA that transports information…

Q: hutations in a structural gene (coding for a protein) have a null phenotype. How many different…

A: Nonsense mutations : It is a genetic mutation in a DNA sequence that results in a shorter ,…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

A:

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Q: Mutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency…

A: Since we answer only three subparts of a question at a time, therefore we are answering the first…

Q: three different types of loss of function mutations and in each case explain how the mutation exerts…

A: A mutation is any alteration of the base sequence of the DNA or RNA. Since mutation alters the base…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr.…

A: The translation is a process where a mature mRNA sequence is converted into respective amino acids…

Q: Identify the labeled factors in the figure below (A and B) and indicate the direction of…

A: Hi dear, here's your answer.can you please give me an upvote. TBP and TFIIB bind and form stable…

Q: The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation…

A: sickle cell anaemia is caused by inherited abnormal hemoglobin that causes the sickling of red blood…

Q: Group 3) Replacing an A with a T in a hemoglobin gene is associated with sickle-cell anemia in…

A: Sickle cell disease (SCD) is a hereditary illness caused by a mutation in both copies of the HBB…

Q: Genetic expression involves transcription and translation. Match the structure or molecule to the…

A: We all know that central dogma is a very basic and important procedure in every cell.There are…

Q: For transcription to occur, the promotor region of DNA will

A: Transcription Transcription is the process of synthesis of mRNA strand from DNA strand. In the…

Q: E channel Charged tRNA Anticodon for START Initiating factors Release factors III III E III = exit…

A: The transition of mRNA into protein is known as translation, and it is a fundamental process in…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA…

A: RNA splicing is a kind of RNA processing in which a newly made precursor-mRNA is transformed into a…

Q: "Place the following prokaryotic translation events in order: translocation, binding of initiator…

A: The correct answer to this particular question will be, assembly of small and large ribosomal…

Q: What type of mutation is shown below:

A: Structural chromosomal mutations refer to the changes in structure of a chromosome due to insertion,…

Q: In Sickle Cell Disease, the 6th amino acid after the START codon is different than it is in wildtype…

A: A mutation is a permanent alteration or change in the nucleotide sequence of DNA (deoxyribonucleic…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.