DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC  TCT  GGC TCT  CCA  AGT  TGA  ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids?

Q: Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2.…

A: True or false statement Primase is a kind of RNA polymerase that is involved in the replication of…

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: Match the mutation with the correct name. Not all labels are used. Nonsense Mutation Mismatch…

A: Any change in the DNA sequence is known as mutation. Some of the mutations are responsible for…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T A U A R…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A missense mutation is a type of point mutation where a single nucleotide change in the DNA sequence…

Q: Exercises: Directions: Complete the following lines for frame shift mutations. Write each codon on…

A: Mutations are changes that occur in the genetic sequence of an organism. These changes alter the…

Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: A C mRNA (Met Gly F GGG AUGCCCACG UAG Which letter indicates the amino end of the growing…

A: A covalent link known as a peptide bond connects the carboxyl group (-COOH) of one amino acid to the…

Q: at is the difference between sickle-cell A sequence and normal DNA sequence? . Normal DNA sequence:…

A: Any abrupt changes in the DNA sequence results in a mutation. This may or may not change the…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

A:

Q: Match up the DNA mutation with its description: Silent a. a point mutation where one amino acid is…

A: Silent -  g) a point mutation where the amino acid sequence are unchanged Missense mutation -  a) a…

Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…

A: We are given an image of circular double stranded DNA with unwinding of two strands at one point.…

Q: 8. Determine the amino acid chain coded for by the following another A is added after the first…

A: Mutations are the changes in the DNA sequence that may lead to harmful results.Frameshift mutations…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: Identify the type of mutation that occurred to produce the abnormal hemoglobin. Explain why you…

A: Nonsense mutation: It is a condition in which the mutation occurs when a protein loses its function…

Q: If the DNA sequence that coded for a codon that was complimentary to the ANTICODON AAU underwent a…

A: A mutation may be a change within the sequence of DNA. Mutations can occur as a result of the term…

Q: Type of Point Frameshift mutation Substitution Insertion or Deletion 10 (Circle one.) How did the…

A: Nucleus is chief controller of cell in which genetic information is safely stored . It exhibit long…

Q: ntify the type of mutation and how it would affect the protein made (amino acid) if the following…

A: DNA is what is inside the nucleus of mostly all cells. It carries the genetic information which is…

Q: Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose…

A: Introduction Translation is the process through which a cell uses the genetic information relayed in…

Q: What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription…

A: Elongation Factor Thermo Unstable (EF-Tu) is one of the most prevalent proteins in bacteria, making…

Q: Please find the mRNA strand: Amino acid sequence How does the amino acid sequence from the base…

A: BASIC INFORMATION    TRANSLATION  It is the process in which protein is which formed from the…

Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…

A: Introduction AUG(Met) GG(U, C, A, G)(Gly) GU(U, C, A, G)(Val) CA(U, C)(His) AU(U, C, A)(Ile) UA(U,…

Q: Describe the mutation that occurs in the following examples (be specific, if possible): BOAT  to BAT…

A: Mutations are changes or alterations or modifications in the nucleotide sequence of the genome or…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: 7 Pribnow box Sigma factor Hogness box Aminoacyl tRNA synthase Rho factor 8 DNA pol 5 hnRNA RNA pol…

A: Central dogma explains the flow of genetic information in all cells. The three main processes:…

Q: How will this mutation affect the golden retriever puppy?

A: Transcription is the process which makes mRNA from DNA in complementary manner. The A, U, G and C of…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: quizzes/85114/take WebSTAC Dashboard Workday Help | Wa... Home - Workday b Identify the W Second…

A: DNA complementary-CCG ATC TGA GTA TAG CCC  mRNA- GGC UAG ACU CAU AUC GGG

Q: What type of mutation is shown in the diagram?   Why do you think this type of mutation is referred…

A: Mutations are alterations in the gene sequence due to presence or interference of certain mutagenic…

Q: Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase ODNA…

A: Option 4 is the answer.RNA polymerase.

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr.…

A: The translation is a process where a mature mRNA sequence is converted into respective amino acids…

Q: The following is an example of what type of mutation?   Normal DNA: 5' - ATGACGTCA - 3'…

A: In genetics, mutations are fundamental processes that underlie the diversity of life. They involve…

Q: Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes…

A: The mRNA at the third position is AUG and it is called Initiation codon.

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: Match the THE BEST DESCRIPTION with the proper enzyme. RNA Polymerase I RNA Polymerase II RNA…

A: The central dogma of molecular biology is a theory that describes the flow of genetic information in…

Q: When does DNA replication occur in the cell cycle? Replicate this strand of DNA: ATTCGC TAG…

A: The cell cycle is a sequence of events before cell division occurs, it prepares cells for division.…

Q: Indicate the class of drug that is stopping polypeptide translation: change 30S subunit…

A: Translation is the process of Synthesis of proteins with the help of mRNA, tRNA and ribosome. Some…

Q: Write a paragraph about transcription, and include the following terms: transcription factors,…

A: Transcription is a process in which RNA molecule is produced from the DNA template strand or non…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.