Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced: methionine, asparagine, alanine, cysteine, and arginine New DNA strand: 3'-TACTTACGACGGCCACT-5' MRNA: Amino Acids: Type of Mutation:

Q: What happens to the pre-mRNA before it migrates to the cytoplasm? Explain

A: Answer: TRANSCRIPTION : It is the process in central dogma where DNA is transcribed in to RNA by…

Q: How are amino acids brought to the sites of the cell where translation takes place? What is an…

A: Introduction In this question we will discuss how are amino acids brought to the sites of the cell…

Q: What is RNA splicing?

A: RNA is a long chain of ribonucleotides connected together via phosphodiester bonds. It works in gene…

Q: Why is mRNA modified after initial transcription?

A: Transcription is the process in which complementary strands of DNA act as a template and transcribed…

Q: Why will a mistake in the RNA code alone not become a mutation?

A: A change in the genetic code is called a mutation when it becomes a permanent part of the genome of…

Q: What enzymes are involved in production of both miRNA and siRNA?

A: RNA is one of the major genetic materials present in living and non-living (such as viruses) systems…

Q: What are Suppressor mutations in tRNA genes?

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…

Q: what is it called when an mRNA is edited and where does it happen?

A: Commonly it’s known that mRNA is produced during the process of transcription which will then go for…

Q: What does a mutation in the DNA do to the mRNA?

A: A mutation is a mistake within the deoxyribonucleic acid sequence of an associate organism.…

Q: Describe the three major modifications that occur duringthe processing of an mRNA.

A: the three major modifications that occur during the processing of an mRNA are :

Q: How is pre-mRNA processing regulated? Give examples

A: pre- mRNA processing regulated : pre- mRNA processing events are  1) 5' capping  2) Polyadenylation…

Q: control

A: Post transcriptional control is the control of gene expression at the RNA level.  It occurs once the…

Q: What are Trna-THE ADAPTER MOLECULES?

A: RNA (ribonucleic acid) is one of the nucleotide chains, primarily composed of the nitrogen bases…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Define the Post-translational modifications. ?

A: Post-translational modifications also PTMs are changes made to protein after synthesis and are…

Q: Where in eukaryotic cells does mRNA synthesis occur? To where do these molecules migrate?

A: Eukaryotic cell: This cell contains the nucleus, lysosomes, endoplasmic reticulum, mitochondria,…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: Where does reverse transcription occur?

A: Retrovirus is classified under class VI virus. They are single stranded RNA viruses which replicate…

Q: What is RNA editing, how can it increase the number of proteins that can be formed from a single…

A: RNA editing also participated in the variations of proteomics sequence. In many types of cancers…

Q: which enzyme is used in the processing of miRNAs that are encoded in the genome but not in the…

A: Introduction Short interfering RNA or siRNA along with miRNA with DICER enzyme form the silencing…

Q: How do cells make a mature mRNA from a gene whose coding sequences are interrupted by introns?

A: During the splicing of an RNA molecule, there are two major parts, one is a coding part, known as…

Q: How are proteins affected if the dna code is mutated

A: When a gene mutation occurs, the nucleotides are in the wrong order. It means that coded genes are…

Q: Name the three main stages of pre-mRNA processing. Explain the importance of each of the stages of…

A: Pre-mRNA, or precursor mRNA, is an immature RNA molecule that is transcribed from a gene in the cell…

Q: How do the stop codons UAA, UAG, and UGA know to form? What if a protein stops synthesizing too…

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid. The…

Q: What is the production of RNA called and what is the enzyme that catalyzes the process?

A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…

Q: What determine the RNA Spliceforms of a Gene Are Translated ?

A: The initial RNA that is transcribed from a gene's DNA template must be processed before it becomes a…

Q: post-transcriptional modifications that occur in mRNA and tRNA.

A:

Q: How is mRNA edited?

A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…

Q: What is methylation ?

A: The chromatin of a chromosome is made up of DNA and proteins. DNA carries the genetic instructions…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.