G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 +. с AUA J AUG Met GUU GUC GUA GUG Val ACA ACG GCUT GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys GAU ASP GAAT GAGJ Glu Mutation 4 The protein produced will have a different amino acid AGG Arg GGU GGC GGA GGG Gly 1235 ATT 1235 TTT 0102030 U Mutation 3 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter The mutation occurs in the promoter region, and this means that the mRNA cannot be produced G 1535 Affected

(11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which may lead to a knockout due to an error in DNA repair? The starting and the end coordinate positions of the DNA fragment on the chromosome are indicated at the beginning and end of the sequence, respectively. 110,001 ATC GGT ATC ATT GCA CTG ACC AGA GGC TAC 110,030 A) Between 110,023 (G) and 110,024 (A) B) Between 110,021 (C) and 110,022 (A) C) Between 110,020 (C) and 110,021 (C) D) Between 110,009 (C) and 110,010 (A)

22. ere to search Normal AUG AAG UUU GGC GCA UUG UUA leu stop met lys phe gly ala Mutation AUG AAG UUU AGC GCA UUG UUA Met lys phe ser ala leu stop What type of mutation has occurred according to the diagram above? point mutation frameshift mutation no mutation has occured chromosomal mutation

a. What is your epigenome (i.e. epigenetics)? b. Does lifestyle affect your epigenome? Explain -c. Does your epigenome change with age? Explain d. What is epigenetic therapy? Is it working? Explain Edit View Insert Format Tools Table 12pt v Paragraph v в I Address DELL F7 F8 F9 F10 F1 F4 F5 F6 # % & 3 4 6. 7 8 9 Y ...

4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).

Describe how a mutation can occur using the image shown

what is the correct order ?

DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC TCG  GCT  CTC  CCA  GTT  GAA  CT    Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids?         2. DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC  TCT  GGC TCT  CCA  AGT  TGA  ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids? 3. DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC  TCC  GGC  TCT  CCC  ACT  TGA  ACT Original Amino acid: Mutated Amino Acid: What type of mutation has occurred in the sequence? How does it affect the expression of amino acids?           4. DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC  TCC  GGC  TCG  CCC  ACT  TGA  ACT Original Amino acid: Mutated Amino Acid: What of mutation mutation has occurred in the sequence? How…

You have 2 genes side by side on a chromosome, gene A and gene B. In your cell your RNASE enzyme that degrade MRNAS starting at their poly A tail is no longer functional. Choose the description that best describes the end result of this mutation. O a No MRNA can be degraded and resulting proteins will forever be made in the cell O b. There is no etfect on the cell O c. Gene A MRNA cannot be degraded and resulting Protein A will forever be made in the cell Od. Gene B MRNA cannot be degraded and resulting Protein B will forever be made in the cll

C. Two mutations are known in the population, one shaded in yellow and one in blue, shown on the TEMPLATE DNA sequence below. Ursula has a mutation in the yellow- shaded underlined nucleotide: instead of an A in this position, she has a T. 5' AATCATAACTCATTG 3' What type of mutation does Ursula have? Second position First position (5 000 0 UUU UUC phe UUA UUG COU leu CỰU CUC CUA COO CUG ADO AUU AUC ile nov AUA AUG met GUU GUC GUA GUG val UCU UCC UCA ser UCA UCG COU CCU cce CCC CCA pro CCA CCG ACU www ACC ACA ACG GCU GCC GCA GCG thr ala UAU tyr UAC UAA Stop UAG Stop CAU CAC his CAC CAA gin CAG AAU AAC asn AAC AAA lys AAG GAU GAC asp glu GAA GAG UGU UGC cys UGA Stop UGG trp CGU Missense Silent Nonsense Frameshift CGC CGA arg CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Initiation Termination ser arg gly DUAG DUMU DUAU DUAG Third position (3-end)