Describe transcriptional components in E. coli for each step of transcription, explain each subunit of RNA polymerase, promoter region, initiation stage, the reaction involved in elongation during RNA synthesis, any important proteins, and termination stage

Describe transcriptional components in E. coli for each step of transcription, explain each subunit of RNA polymerase, promoter region, initiation stage, the reaction involved in elongation during RNA synthesis, any important proteins, and termination stage

Name: Describe transcriptional components in E. coli for each step of transc
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Describe transcriptional components in E. coli for each step of transcription, explain each subunit of RNA polymerase, promoter region, initiation stage, the reaction involved in elongation during RNA synthesis, any important proteins, and terminatio

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

Consider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?
Define both transcription and translation. In addition, describe the role(s) of each of the following in the processes of gene expression and protein synthesis: DNA, mRNA, tRNA, rRNA, ribosome(s), RNA polymerase, codon, anticodon, amino acid(s) and polypeptide(s). Be detailed in your answer.
Briefly describe the significance of regulatory factors in transcription process. Why the promoter is called an essential regulatory element.
Explain the process of transcription in eukaryotic systems by considering the CDK9 gene (search more information about the function of CDK9 in relation to RNA polymerase II). If CDK9 is an example of a gene to be transcribed, explain from initiation, elongation, to termination with proteins involved, by including the important general transcription factors, mention which RNA polymerase.
Discuss the eukaryotic transcription process and mention the enzymes and components needed in the process.
Discuss the process of eukaryotic transcription in detail and mention the specific enzyme needed in each stage.
Explain the process of transcription in prokaryotes, including the following: promoter region, RNA polymerase, 5’-3’ direction, free nucleoside triphosphates, complementary base pairing, terminator region.
Explain briefly the transcription termination stage.
The sigma factor protein's role in transcription in E. coli includes which of the following? None of the answer options are correct. plays a role in transcription termination forms part of the core enzyme required for transcription initiation helps the siRNA to bind to the promoter All of the answer options are correct. contributes to the proof-reading activity of RNA polymerase And The role of tRNA is to serve as an intermediate in the decoding of genes. serve as general translational components of the ribosome. facilitate protein trafficking in protein secretion. facilitate splicing of pre-messenger RNAs. act as vehicles bringing amino acids to the site of protein synthesis. None of the answer choices are correct.
Briefly describe three stages of transcription. How is transcription initiated? How is transcription terminated?
Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the following EXCEPT: transcription of DNA corresponding to both introns and exons. transcription of the DNA corresponding to the gene of the polypeptide which may include UTRS (c) RNA synthesis by RNA polymerase II. the splicing together of a number of exons in the DNA prior to transcription.
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?