Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented as boxes) are found in the mature mRNA. Transcription starts at the arrow labeled TSS, transcription stops at the line labeled TT, and the promoter location is indicated by the line. The indicated DNA sequences for two individuals are found within exon 2 as indicated, with Individual 2 having a mutation. Both sequences are in-frame with the upstream start codon. ATG TAA Promoter (Start codon) (Stop codon) TSS TT Individual 1 5' ACAGGAGGAATAAGTTATGCA 3' Individual 2 5' ACAGGAGGAATAAGTTAAGCA 3' Part 1 You isolate the mature mRNAs for each individual and run them on a northern blot. Compared with the MRNA for Individual 1, you find that the mRNA for Individual 2 is more abundant. the same length. shorter. alternatively spliced. longer. Co0 000

Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter9: Gene Expression And Gene Regulation
Section: Chapter Questions
Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...
icon
Related questions
Question

12

Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented as boxes) are found in the mature mRNA. Transcription starts at the arrow
labeled TSS, transcription stops at the line labeled TT, and the promoter location is indicated by the line. The indicated DNA sequences for two individuals are found within
exon 2 as indicated, with Individual 2 havinga mutation. Both sequences are in-frame with the upstream start codon.
ATG
ТАА
Promoter
(Start codon)
(Stop codon)
TSS
TT
Individual 1
5' ACAGGAGGAATAAGTTATGCA
3'
Individual 2
5' ACAGGAGGAATAAGTTAAGCA 3'
Part 1
You isolate the mature mRNAs for each individual and run them on a northern blot. Compared with the mRNA for Individual 1, you find that the MRNA for Individual 2 is
more abundant.
the same length.
shorter.
alternatively spliced.
longer.
Transcribed Image Text:Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented as boxes) are found in the mature mRNA. Transcription starts at the arrow labeled TSS, transcription stops at the line labeled TT, and the promoter location is indicated by the line. The indicated DNA sequences for two individuals are found within exon 2 as indicated, with Individual 2 havinga mutation. Both sequences are in-frame with the upstream start codon. ATG ТАА Promoter (Start codon) (Stop codon) TSS TT Individual 1 5' ACAGGAGGAATAAGTTATGCA 3' Individual 2 5' ACAGGAGGAATAAGTTAAGCA 3' Part 1 You isolate the mature mRNAs for each individual and run them on a northern blot. Compared with the mRNA for Individual 1, you find that the MRNA for Individual 2 is more abundant. the same length. shorter. alternatively spliced. longer.
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 3 steps

Blurred answer
Knowledge Booster
Types of communication
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning