A gene normally contains an N' terminal ER signal sequence and an internal stop transfer sequence. The ER signal sequence is recognized and used during the protein trafficking process, as normal. After translation is completed a signal peptidase enzyme cleaves the N' ER signal sequence but the internal sequence is not cleaved. Which of the following figures best represents the orientation of the protein product after translation? N Extracellular Extracellular Extracellular Extracellular N' C' Lumen Lumen Lumen Lumen N' A Oc O A В

The pioneer round of translation of an mRNA is very important to identify potentially dangerous mRNAs if per chance they possess aberrant in frame translational stop codons. Their detection leads to rapid degradation through the NMD pathway. What indications would the cell use to signal that an mRNA possesses an in frame stop following the pioneering read? Choose one. a) The mRNA has a shorter Poly A tail since it is not being efficiently translated b) If the cap binding protein is no longer associated with the cap it signals to the cell that the mRNA is no longer translatable. c) A stalled ribosomal complex on the mRNA is clearly detectable and since the translational machinery cannot initiate protein synthesis it is recognized as toxic and is degraded by the 26S proteasome. d) If the mRNA contains intron sequences then it is quickly recognized by the ribosomes as being abnornal and is degraded rapidly by the 26S proteasome. e) mRNA species that are still bound by key factors that…

The synthesis of a protein requires that the amino acids that constitute the growing polypeptide chain be covalently linked to the amino acid attached to the tRNA at the aminoacyl site of the ribosome. Which of the following catalyses this reaction? Options:   the aminoacyl tRNA synthetase   eEF2   eEF1-GTP   a large ribosomal RNA   the initiator tRNA met

Place the steps below in the correct order to accurately reflect the steps by which a secretory protein is co-translationally imported into the lumen of the endoplasmic reticulum: As the polypeptide elongates and translocates into the ER, the signal peptidase cleaves the signal peptide. The SRP binds the SRP receptor, directing the ribosome to dock on the ER membrane. Termination of translation, results in the release of the polypeptide into the ER lumen, release of the ribosome from the ER membrane, and closing of the channel. The signal recognition particle (SRP) binds to the signal sequence on a newly synthesized polypeptide and stalls translation. The channel in the ER membrane opens and the polypeptide is inserted into the ER lumen. The SRP is released. A.6-4-2-3-1-5 B.4-2-5-1-3-6 C.3-1-6-2-4-5 D.1-2-3-4-5-6 E.2-6-1-5-4-3

The ribonucleotides C and G we're mixed together with C two times more abundant than G. The resulting RNAS we're translated in a cell free system. Give the amino acids and the relative percentages of each that would be found after the translation. Show all reasoning/calculations. Suppose that di-ribonucleotides (GC) were used to make RNA and then translated in vitro. What would the results be- explain all reasoning and explain how this information could be combined with the information in part A above to try to deduce the genetic code, assuming you didn't already know it.

Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would result from translation? Tyr-met-val-lys-gly Met-val-lys-tyr-gly Met-tyr-lys-val-gly Ser-arg-leu-glu-his-val Gly-met-val-lys-tyr

All translation begin at free ribosomes in the cytosol, yet all secreted proteins are translocated into the ER. What is the one molecule that is responsible for targeting co-translationally translocated proteins to the ER and what are the three events that this molecule mediates between translational initiation and insertion into the ER?

Which of the following events would NOT result in ribosomes stalling on an MRNA during translation? The MRNA in a given region is very highly folded, and the ribosome stalls because the RNA structure blocks its movement. O The correct tRNA is scarce because it is not transcribed very much in the prevailing conditions. The ribosome stalls while waiting for one of the scarce tRNAS to diffuse into the A site. O the release tactor enters the A site, decodes a stop codon and transfers an oxxYgen from water to the carboxyl group of the peptidyl-tRNA in the P site, causing stalling O Starvation for amino acids will reduce the amount of amino-acylated (charged) tRNA the ribosome will stall while waiting for a charged tRNA to enter the A site to decode the next codon

During translation, this mutation results in a change from the amino acid aspartic acid to the amino acid alanine. Which of the following determines how the resulting protein will be affected by this mutation? O Any change in amino acid will determine that the polypeptide chain will not be able to fold into its proper structure. The change in amino acid will determine that a nonsense mutation has occurred and not all amino acids will be added to the polypeptide chain. O The properties of the amino acids will determine whether the interactions within the protein will affect the folding of the polypeptide chain. The substitution of the DNA nucleotide will determine whether there is a change in the folding of the polypeptide chain forming the protein.

Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C CUAGAC UAGAUCUGCUACUAGUAACACĞU