6. The starting scquence of a gene changed from AUGTTCGACGTG, to AUGTTTTCGACGTG What type of mutation is this? To answer the question, please explain: I) what the mutation is? 2) what types of mutation do you know? 3) what are the possible outcomes of mutations?

6. The starting scquence of a gene changed from AUGTTCGACGTG, to AUGTTTTCGACGTG What type of mutation is this? To answer the question, please explain: I) what the mutation is? 2) what types of mutation do you know? 3) what are the possible outcomes of mutations?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: 1) Write one example about mutation in human. 2) Identify if this mutation is harmful or beneficial.

A: A mutation is a term referred to as a change in the DNA sequence. It is a change which occurs in the…

Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: Describe in detail three spontaneous lesions that can lead to mutations. Give examples.

A: Three spontaneous lesions are depurination, deamination, and transversions. 1. Depurination occurs…

Q: What is the mechanism of action of the antibiotic applied to the plate containing the bacteria…

A: UV radiation is a physical mutagen that can directly cause dimerization of pyrimidines, induce…

Q: Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A missense mutation is a type of point mutation where a single nucleotide change in the DNA sequence…

Q: 1. Transcribe and translate the mutated DNA sequences, CIRCLE the mutation, and classify each type…

A: The change in the sequence of the genetic material of an organism that results in any heritable…

Q: 4. 16B (Eukaryotes): Describe 4 factors that differentiate eukaryotic chromosomes/genome from a…

A: Nucleus is a chief controller of the cell which carries genetic instructions . It comprises of…

Q: What are deletion mutations? Also plzz mention its types Quickkkkk

A: The mutation causes alteration in the nucleotide sequence of DNA. It is caused by natural as well as…

Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…

Q: the following mutations silent, missense, nonsense, or frameshift mutations, why? The original…

A: MUTATION:- It is the heritable change in the nucleotide sequence of the genes of an organism.. For…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

Q: G-LO37 Identify the consequences of mutations in different regions of a gene. The image below…

A: Introduction Gene expression is a multistep pathway by which the genes on DNA are decoded to their…

Q: 1. What are the new DNA sequences and the corresponding new amino acid sequences of these two…

A: Any change in the DNA sequence is known as mutation. Usually two types of mutations are found that…

Q: 20. In class, we discussed different types of genetic change that can cause a normal gene (proto…

A: There are two common causes of most cancers involves mutations in genes called proto-oncogenes and…

Q: 13. An investigator is studying epigenetic markers in patients with retinoblastoma. It is most…

A: Retinoblastoma is a form of cancer that develops in the retina of the eye. It is rare and life…

Q: )A scientist compares the sequence of a disease gene and a healthy gene and finds that these two…

A: The gene is the unit of heredity that is carried out from the parents to the offspring. This…

Q: 45) A patient's mother died from an incurable neurological disease. The patient wants to test his…

A: Neurological diseases are a group of disorders that affect the nervous system, which includes the…

Q: Discuss why a genetic disease might have a particular age of onset.Would an infectious disease have…

A: Different genetic diseases result in different abnormalities in the human genome. A genetic disorder…

Q: What types of mutations occur (i.e. describe base substitution vs. frameshift, silent, missense, and…

A: A mutation is a permanent change in the sequence of DNA, which occurs during the recombination or…

Q: 28. What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: silent mutation is a type of point mutation in DNA that doesn't show any observable effect on the…

Q: 1. State the central dogma of molecular biology.

A: The central dogma of molecular biology stands as a foundational principle elucidating the intricate…

Q: What is the key component(s) of usher syndrome. A) The Effect of mutation and Hot-spots of mutation?…

A: Usher syndrome is a hereditary autosomal disorder passed down through the generations from parent to…

Q: 18. The DNA sequence M, shown below, is the sense strand form a coding region known to be a…

A: * Frameshift mutation is a mutation in which insertion or deletion of nucleotide occurs which…

Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…

A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…

Q: 32. A 23-year-old man comes to the physician because of a 1-month history of weakness and muscle…

A: Myoclonic epilepsy with ragged red fibers or MERRF syndrome is an inherited disease condition that…

Q: 2. Genetics enables us to understand how proteins interact with one another within the context of a…

A: The study of genes, genetic diversity, and the passing of traits from parents to children are all…

Q: gene mutation

Q: A mutation in the coding region of a gene may alter the of the gene. protein-coding region may alter…

A: Mutations are changes in the DNA sequence of an organisms genome. DNA is the genetic material that…

Q: 9.) Describe the molecular mechanisms of mutagenesis. Consider Inciuding the bases impacted, the…

A: Mutagenesis is the process by which the genetic information of an organism gets changed by mutation.…

Q: Describe four types of point mutations: transitions,transversions, deletions, and insertions.

A: A rapid change in the sequence of DNA (deoxyribonucleic acid) due to physical or chemical factors is…

Q: 1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell…

A: * Sickle cell anemia is blood disorder in which red blood cells becomes mis shapen and turns into…

Q: 18) MUTATIONS: A. Explain the difference between a point mutation and a frameshift mutation. B.…

A: Mutations are the gradual changes that occur in our DNA sequence because of several factors such as…

Q: Please explain the different type of mutations and how do they occur?

A: Mutation is change taking place in sequence of DNA which can occur either because of mistake during…

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Which is generally more serious—a missense mutation or a nonsense mutation?
5.) You have identified a mutant with the following phenotype: a) Explain what has most likely happened to the chromatin in the mutant fly. b) Which enzyme do you think has undergone a mutation in your mutant fly? There is more than one correct answer, just give one possibility. c) How did the mutation in the enzyme you identified in part b affect the activity of that enzyme in order to see the phenotype we observed above?
8. A mutant that has a nutritional requirement for growth is an example of a(n) A) heterotroph B) auxotroph C) autotroph D) organotroph 9. In the Ames test the number of histidine auxotroph colonies growing on media lacking histidine when exposed to a potential chemical mutagen is. proportional to the likelihood that the chemical is mutagenic. A) Directly B) Inversely 10. Thymine dimers result from A) ionizing radiation B) nucleoside analogs C) non-ionizing radiation D) none of the above 12. RecA proteins are NOT required for homologous recombination? A) True B) False 13. Increasing genetic variability by the uptake of DNA from the environment is A) transduction B) transformation C) a mutation D) conjugation 14. Which of the following features are common to transformation, transduction, and conjugation? (1) unidirectional transfer of genes (2) incomplete gene transfer (3) homologous recombination (4) meiosis occurring in the recipient A) 1, 2, 4 B) 1, 2, 3 C) 3,4 D) 1,2 15. What is…
Discuss three potential benefits and three possible harmful effects of genetic modifications on humans.
Can you explain how to find what mutation 2 is with elaborate step?
1 and/or 2 please
14
3). Explain a substitution mutation 4) Explain a deletion mutation 5). Explain an insertion mutation
G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 A + с AUA ACA AUG Met ACG GUU GUC GUA GUG Val GCU GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 + GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys AGA Arg GGU GGC GGA GGG GAC Asp GAA Glu GAGJ Gly The protein produced will have a different amino acid 1235 ATT 1235 TTT 070 2070 ALL The mutation occurs in the promoter region, and this means that the mRNA cannot be produced 1535 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter G 1535 с Affected
36. Non-sense mutation results to the formation of a shorter protein than what should be synthesized. true or false
5b. When you mutagenize a diploid organism, chances are astronomically high that you will be creating a heterozygote on the spot. Why would your mutation be heterozygous and not homozygous?
1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'