Table of the Standard Genetic CodeMiddle base5'- C_-3'UCU Ser (S) |UAU Tyr (Y)UCC Ser (S) UAC Tyr (Y)UCA Ser (S)UCG Ser (S)UAG TerCCU Pro (P) CAU His (H)CCC Pro (P)CCA Pro (P) CAA GIn (Q)CCG Pro (P) CAG GIn (Q)5'- _U -3'5'-_A_-3'5'-_G_-3'5'-U_-3' UUU Phe (F)5'-U_-3' UUC Phe (F)5'-U_-3' |UUA Leu (L)5'-U_-3' UUG Leu (L)5'-C_-3' |CUU Leu (L)5'-C_-3' |CUC Leu (L)5'-C_-3' CUA Leu (L)5'-C_ -3' CUG Leu (L)UGU Cys (C) 5'-_U-3'5'-_C-3'5'-_A-3'UGG Trp (W) 5'-_G-3'5'- U-3'5'-C-3'5'-_A-3"5'- G-3'5'- U-3'5'-_C-3'5- А-3'5'-_G-3'GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3'5'-C-3'GGA Gly (G)5'-_A-3'GGG Gly (G) 5'-_G-3'UGC Cys (C)UGA TerUAA TerCGU Arg (R)CGC Arg (R)CGA Arg (R)CGG Arg (R)ACU Thr (T)|AAU Asn (N) AGU Ser (S)AAC Asn (N) AGC Ser (S)AGA Arg (R)AGG Arg (R)CAC His (H)5'-A_-3' |AUU lle (1)5'-A_-3' AUC Ile (1)5'-A_-3' |AUA lle (1)5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K)5'-G_-3' GUU Val (V)5'-G_-3' GUC Val (V)5'-G_-3' GUA Val (V)5'-G_-3' GUG Val (V)ACC Thr (T)ACA Thr (T) AAA Lys (K)GCC Ala (A)GAC Asp (D)GCA Ala (A) GAA Glu (E)GCG Ala (A) GAG Glu (E)GGC Gly (G)Non-polarAcidicBasicPolar-unchargedTerminationInitiation5' base3' base 1. Consider the genetic code for the amino acid phenylalanine (abbreviations: Phe, F) and single base substitutions in its codons.A. How many codons does Phe have?B. List the set of different amino acids could be reached by missense mutations in each of its codons.C. List the sub-set of these amino acids that arise from transition mutations and the complementary set that arise fromtransversion mutationsD. Is the set of missense mutations caused by transitions more or less conservative in general chemical properties relative toPhe than those that could be reached by transversion mutations?E. Is a nonsense mutation of any of Phe's codons possible?

A codon is the triplet sequence of DNA or RNA nucleotides which corresponds either to specific amino…

. Consider the genetic code for the amino acid phenylalanine (abbreviations: Phe, F) and single base substitutions in its codons. A. How many codons does Phe have? B. List the set of different amino acids could be reached by missense mutations in each of its codons. C. List the sub-set of these amino acids that arise from transition mutations and the complementary set that arise from transversion mutations

. Consider the genetic code for the amino acid phenylalanine (abbreviations: Phe, F) and single base substitutions in its codons. A. How many codons does Phe have? B. List the set of different amino acids could be reached by missense mutations in each of its codons. C. List the sub-set of these amino acids that arise from transition mutations and the complementary set that arise from transversion mutations

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 16P: Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins,...

See similar textbooks

Similar questions

BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG
What is thee tRNA anticodon for the first 5’-ACGAUC-3’?
5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd G
With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?
For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'
in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region of an unknown Escherichia coli genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS -3' -5' +1 (i) Name the specific regions that can be recognized by sigma factor and indicate the locations in the diagram above. (ii) How does Sigma factor trigger the initiation of transcription?
5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?
Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9…
(a-32P) GMP INCORPORATED (pmol) N 111 (a) (b) (c) 20 5 (min) 26 10 The image above shows an experiment to investigate the effect of TFIIS on transcription by RNA polymerase II. Why were NTPs added to the reaction last?
5'....TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAA actgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene