4. 16B (Eukaryotes): Describe 4 factors that differentiate eukaryotic chromosomes/genome from a prokaryotic chromosome/genome. 5. Compare/contrast 4 differences between Eukaryotic and Prokaryotic GENE structure & gene EXPRESSION (including regulatory sequences).

10. What are the different structural organizations during packaging of DNA in a eukaryofic cell? What is meant by denaturation of DNA? Define hyperchromicity of denaturation? What are extracellular matrix proteins? List their functions. How has fluorescence microscopy contributed to one understanding of the nature of cytoskeleton? a. Nanoparticles and their applications b. Molecular chaperones What are heterotrimeric and monomeric G-proteins? Discuss their functions. Describe the effect of the following molecules on electron transport chain. a. Thermogenin b. Oligomycin c. Atractyloside d. BAL a. Briefly discuss Ramchandran plot. b. What is quaternary structure of proteins? Mention the role of various bond in its structure with the help of an example give its biochemical function. ‘What are liposomes? Discuss their role in medicine. . Differentiate between cerebroside and ganglioside and one disorder associated with each. o SRS

4. This is the same gene as #1, but with a mutation!! (C/G-T/A at base pair 33) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now What type of mutation is this? C. 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATTATTACATTGACTAACG -3' 5 1 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAATAATGTAACTGATTGC -5' C. 1 -+ --+-- --+-- 5. This is the same gene as #1, but with a mutation!! (insertion of CG at base pair 29) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now What type of mutation is this? --+-- -+-- 51- CAAATTAATGGEGGO 5'- CAAATTAATGGCGGCATTTACGATGGTGCGGGATCATTACATTGACTAACG -3' 5 -+-- 1 -+- 3'- GTTTAATTACCGCCG 3'- GTTTAATTACCGCCGTAAATGCTACCACGCCCTAGTAATGTAACTGATTGC -5' -+-

1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'