1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell anemia is caused by a mutation in the HBB gene, which codes for the B- globin chain of hemoglobin. The beginning of HBB is shown here: 5'-ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT..-3' A. Translate this HBB sequence into an amino acid sequence. B. In terms of amino acids, what is the result of the sickle cell mutation, wherein the bolded red A is changed to a T? This single mutation causes hemoglobin to aggregate, causing red blood cells to deform into a sickle-like shape rather than the normal "biconcave disk" shape. C. What would happen if the bolded blue A were mutated to at T? (This is hypothetical; it's not a mutation found in sickle-cell disease.)

G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 A + с AUA ACA AUG Met ACG GUU GUC GUA GUG Val GCU GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 + GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys AGA Arg GGU GGC GGA GGG GAC Asp GAA Glu GAGJ Gly The protein produced will have a different amino acid 1235 ATT 1235 TTT 070 2070 ALL The mutation occurs in the promoter region, and this means that the mRNA cannot be produced 1535 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter G 1535 с Affected

A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’   what type of mutation is this?   Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?

The pathway for arginine biosynthesis in Neurospora crassa involves several enzymes that produce a series of intermediates as shown. O O O O ornithine citrulline ARG-E arginosuccinate arginine N-acetylornithine arginine You did a cross between ARG-E ARG-H* and ARG-E* ARG-H¯¯ Neurospora strains and identified an Arg- strain from an NPD tetrad. (Assume that Neurospora forms tetrads in the same way yeast do.) Which compound would rescue growth of this Arg- spore? N-aceltylornithine ARG-F ornithine citrulline ARG-G ARG-H → argininosuccinate

1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50

An individual with the genetic condition cystic fibrosis has CFTR protein with the amino acid histidine (at position 482), where the normal CFTR protein has arginine. No other changes are observed in the protein. This is the result of a ____ mutation. Select one: a. nonsense b. frameshift c. silent d. missense

2. Sickle-cell anemia is a genetic disorder caused by the abnormal gene for hemoglobin S. A single substitution oc- curs in which glutamic acid is substituted for valine in the sixth position of the hemoglobin molecule. This change reduces hemoglobin's ability to carry oxygen. a. Discuss the process by which mutation occurs in base substitution. b. Biologists used gel electrophoresis to initially identify the mutant gene. Explain how gel electrophoresis could be applied to the identification of the gene mutation. Discuss the use of restriction enzymes. c. Hemoglobin S is transmitted as a simple Mendelian allele. Describe the outcome if a female who does not carry the abnormal allele mates with a male homozygous for the disease. Include a Punnett square and pheno- typic and genotypic ratios.

6a. Complete this flowchart to describe an example of how different versions of a gene can result in different characteristics. In the DNA, different versions of the gene for a clotting protein have a different sequence of different sequence of . in MRNA different sequence of in the clotting protein different structure and function of the clotting protein different characteristics (e.g. normal clotting vs. hemophilia)

2 I 3 4 5 6 I 7 Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. sheet: Deletio... obin DNA C A... globin DNA C... Sickle cell hemoglobin mRNA: Sickle cell hemoglobin Amino Acid sequence: 4. What type of mutation is this? Please explain why.