
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question

Transcribed Image Text:1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell anemia is caused by a mutation in the HBB gene, which codes for the B-
globin chain of hemoglobin. The beginning of HBB is shown here: 5'-ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT...-3'
A. Translate this HBB sequence into an amino acid sequence.
B. In terms of amino acids, what is the result of the sickle cell mutation, wherein the bolded red A is changed to a T? This single mutation causes hemoglobin to aggregate,
causing red blood cells to deform into a sickle-like shape rather than the normal “biconcave disk" shape.
C. What would happen if the bolded blue A were mutated to at T? (This is hypothetical; it's not a mutation found in sickle-cell disease.)
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-arrow_forward1. "Interferons (IFNs)‐α and ‐β are expressed in response to a virus infection and are released from the cell in which they are produced. IFNs induce an antiviral state in other neighboring cells. a. Which cellular process is inactivated when IFN‐treated cells are infected with a virus? b. One arm of the IFN‐induced antiviral state is the synthesis of 2′,5′‐oligoA in response to viral infection. In one sentence or a simple diagram, what is the effect of this on the cell? c. Another arm of the IFN‐induced antiviral state is activation of the protein kinase in response to viral infection. In one sentence or a simple diagram, what is the effect of this on the cell? d. All cells contain the genes for IFNs. IFN synthesis is stimulated by virus infection. Would you expect a cell that has been treated with IFN to synthesize IFN in response to a viral infection? Explain your answer."arrow_forwardWhat type of mutation is shown below: CGG GGG GAG TCT TTT TAT GCA GCT changes to: CGG GGG GAG CTT TTTATG CAG CT A frame shift mutatuion which resulted from a deletion. O Point mutation in which one nucleotide was changed. O Point mutation in which a length of nucleotides were changed. O A frame shift mutatuion which resulted from an insertion.arrow_forward
- G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 A + с AUA ACA AUG Met ACG GUU GUC GUA GUG Val GCU GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 + GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys AGA Arg GGU GGC GGA GGG GAC Asp GAA Glu GAGJ Gly The protein produced will have a different amino acid 1235 ATT 1235 TTT 070 2070 ALL The mutation occurs in the promoter region, and this means that the mRNA cannot be produced 1535 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter G 1535 с Affectedarrow_forwardA woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?arrow_forwardThe pathway for arginine biosynthesis in Neurospora crassa involves several enzymes that produce a series of intermediates as shown. O O O O ornithine citrulline ARG-E arginosuccinate arginine N-acetylornithine arginine You did a cross between ARG-E ARG-H* and ARG-E* ARG-H¯¯ Neurospora strains and identified an Arg- strain from an NPD tetrad. (Assume that Neurospora forms tetrads in the same way yeast do.) Which compound would rescue growth of this Arg- spore? N-aceltylornithine ARG-F ornithine citrulline ARG-G ARG-H → argininosuccinatearrow_forward
- 1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50arrow_forwardAn individual with the genetic condition cystic fibrosis has CFTR protein with the amino acid histidine (at position 482), where the normal CFTR protein has arginine. No other changes are observed in the protein. This is the result of a ____ mutation. Select one: a. nonsense b. frameshift c. silent d. missensearrow_forward2. Sickle-cell anemia is a genetic disorder caused by the abnormal gene for hemoglobin S. A single substitution oc- curs in which glutamic acid is substituted for valine in the sixth position of the hemoglobin molecule. This change reduces hemoglobin's ability to carry oxygen. a. Discuss the process by which mutation occurs in base substitution. b. Biologists used gel electrophoresis to initially identify the mutant gene. Explain how gel electrophoresis could be applied to the identification of the gene mutation. Discuss the use of restriction enzymes. c. Hemoglobin S is transmitted as a simple Mendelian allele. Describe the outcome if a female who does not carry the abnormal allele mates with a male homozygous for the disease. Include a Punnett square and pheno- typic and genotypic ratios.arrow_forward
- 6a. Complete this flowchart to describe an example of how different versions of a gene can result in different characteristics. In the DNA, different versions of the gene for a clotting protein have a different sequence of different sequence of . in MRNA different sequence of in the clotting protein different structure and function of the clotting protein different characteristics (e.g. normal clotting vs. hemophilia)arrow_forward2 I 3 4 5 6 I 7 Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. sheet: Deletio... obin DNA C A... globin DNA C... Sickle cell hemoglobin mRNA: Sickle cell hemoglobin Amino Acid sequence: 4. What type of mutation is this? Please explain why.arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education