1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'

1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'

Name: 1. Determine the effect of the following mutations on the DNA sequenc
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation isdescribed after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THISQUESTION).Adenine nucleotide (A shown in red below) was inserte

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAACGTTAC 8b. Where did the mutation take place?
7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCCGTTAC 7b. Where did the mutation take place?
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above)
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
2 a) The following nucleotide sequence is found on the template strand of DNA: 3-TAC TGG CCG TTA GTT GAT ATA ACT-5" Determine the amino acids of the encoded peptide, then provide the altered amino acid sequence of protein that would result from each of the following mutations and provide their classification (eg. Missense, nonsense, etc). 益券 A transition at nucleotide 11 A transition at nucleotide 13 A one-nucleotide deletion at nucleotide 7 AT to A transversion at nucleotide 15 An addition of TGG after nucleotide 6 A transition at nucleotide 9
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)
Procedure: Refer to the Genetic Code Table below to identify the right amino acid coded. To determine the order of bases in the first column (uNA), second column (codon) and the third column is the anticodon. Consider the complementary base pair in DNA and in RNA To identify the amino acid, took at the bases in the MRNA codon, example AUG using the Genetic Code Table. Lool: for the first letter of the MRNA codon on the left side of the genstic code table (A), the second letter of the MRNA on the second letter column (U), and the third letter on the right-side column (G). AUG codes for the amino acid -methionine, Do the same with the other codons in the chart. Genetic Code Table 2nd posttion of codon UUU Phe Phenylalanine UCU Ser S Serine Phenylalanine UC C Ser S Serine UCA Ser S Serine UCe Ser S Serine CCU Pra P Proline UAU Tyr Y Tyrosine UAC Tyr Y Tyrosine UGU Cys C ysteine UGC Cys C Cysteine UUC Phe F UUA Lau UUG Leu CUU Leu CUC CUA Leucine UGA UGG Trp W Tryptophan G stop stop L…
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid