3. The protein with the LEAST migration in SDS-PAGE is [ Select ] Select ] ACB
Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…
A: 5' cap help in translation and prevent degradation of m- RNA and poly A tail help on initiation of…
Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)
A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…
Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…
A: The protein synthesis occurs in cytoplasm by the process of translation.
Q: 2. Explain the method used for stabilizing the crosslinks between two polypeptide chanis
A: Polypeptides are made up of chains of amino acids joined together by peptide bonds. The free amino…
Q: 4. Assuming the translation product is an enzyme, explain its role in the final expression of a…
A: The genetic material of a cell, that is, the DNA (deoxyribonucleic acid) contain various genes that…
Q: 3. List the sequences for the "stop" codons.
A: A codon is a three-nucleotide long stretch present in the messenger RNA (ribonucleic acid). It codes…
Q: 4. What is the use of miRNAs in the cell? Please discuss the effect of a mutant Argonaute protein on…
A: RNA (ribonucleic acid) is a polymer of nucleotides that is composed of pentose sugar, a nitrogen…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…
Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF
A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…
Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…
A: The translation is a process by which proteins are synthesized. It is the last step of the central…
Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…
A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…
Q: 2. Fill in the blanks. Next week we will analyze the Breseq data. If you see the symbol '/', it…
A: Breseq is a computational pipeline for detecting mutations in short-read DNA re-sequencing data for…
Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhvdrolvzed RNA,
A: RNA (ribonucleic acid) is a single chain polymer of nucleotides that is linked by phosphodiester…
Q: 5. The downstream process for a recombinant protein begins with 100 liters of clarified lysate. At…
A: Protein purification is series of processes to isolate one or few proteins from a complex mixture of…
Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…
Q: The specific sequence component of the bacterial promoter located 10 base pairs upstream of the…
A: A promoter is cis-acting , position dependent DNA sequence which is necessary for accurate and…
Q: most STR fragments used in human forensic analysis are comprised of_____ repeats
A: STR Stands for short tandem repeats, these are short sequences in DNA that make large subunits…
Q: I still do not understand why the number of coding regions are 6 based on the R-loop.
A: An R-loop is nucleic acid structure, which contains three strands. It is made up of RNA-DNA hybrid…
Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…
A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…
Q: 6. The DNA sequence of a portion of the TEMPLATE strand of a gene is 5'-CAATACGTAC-3'. A. Write the…
A: The Central Dogma theory, in Genetics, states that DNA makes DNA through Replication. DNA makes RNA…
Q: 2. [1] Which of the following are NOT necessary components of a. Anticodon b. Polymerase c. Ligase…
A: when the process of transcription completed of DNA to RNA in the nucleus of the cell, ribosomes in…
Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…
A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…
Q: 2. If the DNA strand AAA TCG AGG CCA is transcribed to an mRNA, which 2 points shows an occurrence…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: 1. True or False a) DNA bases, when coiled to histones, become inaccessible to RNA polymerase. b)…
A: Transcription is the process by which the information of DNA are copied into mRNA and this process…
Q: 13- Which statement is not correct for primer design criteria? a) In the length of 18-22 nt b)…
A: A primer is a sequence of short, single-stranded DNA used in the technique of polymerase chain…
Q: Can you please answer number 28 and 29
A: Any alteration in the genome’s nucleotide sequence is called a mutation. Any agent that results in a…
Q: 1. Using the central dogma of molecular biology, explain the terms replication, transcription and…
A: Since you have asked multiple questions, we will answer only the first question for you. If you want…
Q: 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan…
A: Introduction Gene Regulation: Expression of gene is highly regulated in both prokaryotes as well as…
Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG
A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…
Q: 1) You wish to make a restriction map of a 17.0 kb linear fragment. You digest the fragment with…
A: Restriction map is a map of the restriction sites present in gene/DNA sequence. Restriction enzymes…
Q: 6. Which of the following amino acid does not include post-translational modification? a.…
A: Post translational modification is a covalent and enzymatic modification which occurs after the…
Q: 1. What happen to the mutated sequence in the coding region of MT-ATP6 in Leigh's syndrome. Does it…
A: Leigh's syndrome is a rare neurogenetic disorder that affects the central nervous system. The…
Q: 23.. _% SDS is used with proteinase K in DNA purification. 10 20 30 12
A: DNA is the genetic material present in all living cells. In prokaryotes like bacteria, they occur in…
Q: In test tube 1 (no puromycin) you get a polypeptide that is 90 amino acids long. At least how many…
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: 18. In order to m protein. You crea guide RNA comp sequence Gene that the CRISPR Gene Yis neces: a.…
A: CRISPR/ cas 9 Clustered regularly interspaced short palindromic repeats is a gene editing system…
Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…
A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…
Q: What does miRNA stand for? Please explain its biogenesis
A: RNA (ribonucleic acid ) is biological macromolecule which play important role in manufacturing of…
Q: 8. The CAS9 enzyme (shown in red in the image below arget and cut out specific DNA sequences.
A: As you have not mentioned which part to answer, we are answering first three for you. If you want…
Q: 8. Please describe an experiment to determine if the amino acid sequence PKWKAAV can serve as a…
A: A nuclear localization signal (NLS) is an amino acid sequence that 'marks' a protein for nuclear…
Q: 3. We said that this 60 base-pair sequence contains an entire ORF. But if, instead, the same…
A: Introduction :- Reading frame is a sequence of bases in messenger RNA (or derived from DNA) that…
Q: 1. What happens during transcription? Possible sentence frame: Transcription is the process in which…
A: Need to fill the blanks related to transcription process.
Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…
A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…
Q: 7. Which of the following base sequences are probably not recognition sites for cleavage by…
A: Restriction endonucleases are the molecular cutters which is used to split DNA in the center but…
Q: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme…
A: The restriction site is the site which is a type of specific genetic sequence present on the DNA…
Q: 3. Why do Class I DNA based transposable elements have terminal inverted repeats?
A: Transposable elements also known as transposons as well as jumping gene. As the name suggests it is…
Q: 2. What is the minimum number of single nucleotide substitutions that would be necessary for each of…
A: For amino acid production the DNA is transcribed to RNA and RNA is translated to amino acid…
Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…
A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…
![3. The protein with the LEAST migration in SDS-PAGE is
[ Select ]
[ Select ]
A](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F79dd6ef3-2a15-42b2-b233-c9bfbddd1b76%2F572e01b9-d273-4b59-9595-3e60aca81eb5%2F477ytm7_processed.jpeg&w=3840&q=75)
Step by step
Solved in 2 steps
- 1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Sera. What sequence of fi ve amino acids would give a 14-merprobe with the least degeneracy for probing a library tofi nd your gene of interest? Notice that you do not use thelast base in the fi fth codon because of its degeneracy.b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly?c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.2. A single base addition and a single base deletion approximately 15 bases apart in the MRNA specifying the protein lysozyme for the bacterial virus T4 caused a change in the protein from its normal composition: Lys – Ser - Pro - Ser - Leu- Asn-Ala - Ala - Lys To the mutant form: Lys - Val - His- His - Leu - Met- Ala-Ala- Lys a. From the genetic code, decipher the sequence of mRNA for both original protein and double mutant. b. Which base was added? Which base was deleted? · END -1e) Give the sequence of every codon this tRNA, with the anticodon 5'AGG3', could base pair with (perfect and wobble matches), and name the amino acid coded for by each codon whose sequence you have written.
- 22. Some tRNAs contain inosine, which can base pair with A, C, and U. Why might this be advantageous with ate but not ambiguous? olyp min 33. What is required for molecular surfaces/interfaces to interact with one another for a sufficient amount of time (such as an antibody/antigen)?Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.I'm completely stuck just label protein B and A to see if you can help me I need to find the migrations distance please for both protein (mm) has to be please
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 131. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Ser a. What sequence of five amino acids would give a 14-merprobe with the least degeneracy for probing a library tofind your gene of interest? Notice that you do not use thelast base in the fifth codon because of its degeneracy. b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly? c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.5'....TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAA actgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple1d) What amino acid would a tRNA with the anticodon 5'AGG³' carry?I’m completely stuck just label protein B and A to see if you can help me I need to find the migrations distance please for both protein
