2. What happens during translation? is read and Possible sentence frame: Translation is the process in which is made. This happens by.

Which statement is CORRECT? the primary transcript of RNA is larger than the MRNA the primary transcript of RNA is the same size as the mRNA O the primary transcript of RNA is smaller than the mRNA O both the primary transcript of RNA and MRNA contain introns

3. Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. NOTE: For this problem, transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTСТААТАТТGTGAGATGTТАТАТСССGCСGTCAАСАССАТСАА-3' +------- +------- ---------+ 3'-САСAGGCAGATTATAACAСТСТАСААТАTAGGGCGGCAGTTCTGGTAGTТ-5' 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' ------+ 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' a) Which strand is used as a template for transcription, the top or the bottom? b) Where would the promoter be relative to the start of transcription? c) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA. d) What…

32.

Please explain

19. Predict the effect of a mutation that would alter the Shine-Dalgarno (SD) sequence T / F Initiation of translation would probably be affected T / F Elongation of translation would be faster since ribosome will no longer stall at the SD sequence T / F mRNA levels maybe lower T / F replication would not be affected T / F RNA polymerase would not bind as efficiently

2. Do you think mutation has any direct relationship with codon? Why/Why not? Please explain in your own words. [Max 200 words]

1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'

Can you help me with this question?

9. Identify the TRUE statement about the process of transcription: * ORNA polymerase requires an RNA primer molecule before it can begin transcript ODNA is not needed for the process of transcription. RNA polymerase binds to a promoter region in the DNA to initiate transcription. O During the elongation phase, RNA transcripts are built from 3' to 5'. 10. Which is correct? * Translation occurs in the nucleus; transcription occurs in the cytoplasm O Transcription occurs in the nucleus; translation occurs in the cytoplasm Both transcription and translation take place in the cytoplasm Both transcription and translation occur in the nucleus