2. Explain the method used for stabilizing the crosslinks between two polypeptide chanis
Q: 8 What are the three components of anucleotide?
A: Nucleosides are a combination of a nitrogen base with pentose sugar. The nitrogen base combines with…
Q: 5) List the names of the 5 different base pairs and their letter code. Identify if they are…
A: A base pair is a fundamental unit of double-stranded nucleic acids consisting of two nucleobases…
Q: 4. Draw the structure of EDTA and how it binds metal ions. Draw the structures of Tris buffer in…
A: pH plays a very important role in all biological functions. An optimum pH needs to be maintained in…
Q: Explain why is it necessary for a protein to adopt specific tertiary and quaternary arrangements.…
A: Proteins are defined as large biomolecules, or macromolecules, consisting of one or more long chains…
Q: 4. Indicate whether each of the following words orphrases applies to proteins, DNA, or both.a. a…
A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms that contains coded genetic…
Q: 1. Which of the following rules apply to the synthesis of nucleic acids? A. Nucleotides are added to…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: List the amino acid sequence of the protein coded for.…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…
A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.
Q: Discuss the reasons proteins were generally favored over DNA as the genetic material before 1940.…
A: DNA and RNA are considered as a genetic material. DNA is inherited or transferred from parents to…
Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhvdrolvzed RNA,
A: RNA (ribonucleic acid) is a single chain polymer of nucleotides that is linked by phosphodiester…
Q: 13. The following diagram shows the normal sequence of a particular protein, along with several…
A: DNA is a polymer of nucleotide bases connected by phosphodiester bonds between the ribose sugar and…
Q: 1. Explain why the primary structure sequence -Lys-Leu-Trp-Asp- may promote a-helix formation while…
A: The formation of α helix is occurred due to attachment of H of N of Cα of first (n) amino acid to…
Q: 6. Two possible paint mutations are the substitution of lysine for leucine or the substitution of…
A: Every physiological characteristic or metabolism of our body mainly controlled by proteins. These…
Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhydrolyzed RNA.
A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…
Q: Please describe the events that may result in a mature protein not having methionine as the…
A: Translation process of formation of a sequence of amino acid using messenger RNA as a template.
Q: 8. Explain how to prepare 3 ml of a solution with a concentration of 2ug/5ml from a stock solution…
A: For the preparation of this solution from a concentrated stock solution the formula V1 x S1 = V2 x…
Q: 2. A biochemical analysis of an RNA sample showed 40 % ofnitrogenous bases were cytosine (C). What…
A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…
Q: Using diagrammatic representations, distinguish between: nucleotide, nucleoside and nucleic acid.
A: Nucleotides are organic molecules consisting of a nucleoside and a phosphate. Nucleosides…
Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…
A: Sickle cell anemia is a inherited disorders due to defect in the gene. In this disease mutation…
Q: 13. The following diagram shows the normal sequence of a particular protein, along with several…
A: Mutations are defined as the permanent alteration or change in the DNA sequence that makes up a…
Q: 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine…
A: Codons is a sequence of three nucleotides that corresponds with a specific amino acid or stop signal…
Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…
A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…
Q: 1. What are the three general steps involved in isolation of proteins? Discuss or briefly describe…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Why does a cell use deoxyribonuclease?
A: Introduction: DNA is the basis of the transformation of character from one generation to other…
Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What is the chemic name and formula of the precipitate for the test for phosphate? 2.suppose biuret…
A: Dear students, As the given question has multiple questions and here it is not specified which…
Q: 1. What is the purpose of dichotomous key? 2. Why is this key called dichotomous key?
A: Taxonomy can be defined as a branch of science which deals with the practices of classification.It…
Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…
A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…
Q: 5. Interaction between DNA and protein forms associated complex in different biological environments…
A: Biomolecules undertake complex conjugations with each other to form complexes with unique…
Q: 8. Explain the formation of (a) beta bends, (b) beta loops, and (c) beta sheets
A: Beta sheet also known as beta pleated sheets. Glycine proline,asparagine and aspartic acid most…
Q: 1. Where is the cleavable blocker located on the modified nucleotides used in Illumina sequencing?
A: Illumina sequencing is developed by Solexa and was subsequently acquired by Illumina. This…
Q: 1.) Give one example of a cis-acting regulatory element.
A: Cis-regulatory elements (CRE) include non-coding regions of DNA that regulate the transcription of…
Q: 7. Describe the mutation that causes sickle cell anemia. a. What is the change that occurs in DNA?…
A:
Q: What determines the affinity of a glycan for a GBP?
A: Glycans and glycan-binding protein interaction are a major way of understanding the structure of…
Q: 2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino…
A: The given sequence can be read by combining sets of three nucleotides per amino acids.
Q: 2. A scientist wants to clone a molecule bearing UniProtKB accession number P43657. How will he come…
A: UniProt is a database that is freely accessible to identify the protein sequence and its functional…
Q: 2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the…
A: bp = base pair—one bp corresponds to approximately 3.4 Å of length along the strand 1angstrom (Å),…
Q: Why is yeast rna is insoluble in cold water, ethanol, diluted hydrochloric acid?
A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…
Q: 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ?…
A: Nucleosides contain only sugar and a base whereas Nucleotides contain sugar, base, and a phosphate…
Q: 2. In the given segment in problem 1, illustrate and indicate the direction of synthesis of: a.…
A: The replication process begins with the unwinding of the polynucleotide strand, which forms a…
Q: 3. What are the last three of six nucleotides (bases) of the palindromic site for the enzyme Ndel if…
A: Restriction endonucleases (or restriction enzymes) are enzymes that identify specific sequences in…
Q: 2) Draw the skeletal (line-boad) structure for 2-methylbutanediaicacid.
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 8. Please describe an experiment to determine if the amino acid sequence PKWKAAV can serve as a…
A: A nuclear localization signal (NLS) is an amino acid sequence that 'marks' a protein for nuclear…
Q: 7. Guanidinium group is associated with: a. Tyrosine b. Arginine c. Histidine d. Lysine e.…
A: Amino acids are building blocks of protein and amino acids are composed of an amino group, carboxyl…
Q: 22. Which of the following mutations would be expected to have the most harmful effect on the…
A: Mutations Mutations are defined as any change or alteration in the base sequences of the DNA further…
Q: 1. What is the purpose of hydrolyzing the RNA before conducting biochemical tests? 2. Enumerate…
A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer only one…
Q: 3. If one measures a 20 ul sample of DNA with an absorbance reading at A280 mm of 0.35 and an…
A: Introduction :- DNA ( Deoxy ribonucleic acid ) is made up nucleotide units , which are made up of a…
Q: 1) Describe one inner and one outer approach for the prediction of contact or distance maps in…
A: Protein structure prediction is the process to identify the 3-D (dimensional) structure of a protein…
Q: 1) what is the net charge of the amino acid leucine of it is on the C-terminus end and why? 2) if…
A: Proteins are among the most numerous organic molecules in biological systems, and their structure…
Q: 2. What is the minimum number of single nucleotide substitutions that would be necessary for each of…
A: For amino acid production the DNA is transcribed to RNA and RNA is translated to amino acid…
Step by step
Solved in 3 steps
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 212. Of the two sequences, which is more likely to have helical structure. Explain. a) -Glu-Asp-Glu-Glu-Asp-Leu- b) -Glu-Leu-Asp-Arg-Val-Lys-Lysozyme consist of 4 disulfide bridges while Bovine Serum Albumin(BSA) is 17. However, lysozyme is more rigid compared to BSA. Why? What are the factors affecting the rigidity of their structures? Does the number of α-helixes and β-sheets matter?
- 1.Draw these phosphorylated structures as they would be connected in a polinucleotide (e.g.RNA) in the order A-B. / Show how they combine to form the polynuleotide (i.e. only the end product). Show at any one of these structures where the glycosidic bond occurs 2.Sanger sequencing revealed the sequence of an oligonucleotide to be: d-AGATGCCTGACT. Draw a diagram of the gel banding pattern post capillary electrophoresis i.e. where on the gel would the fragments feature6) Proteins can be modified by phosphorylation, which adds a phosphate group to the hydroxyl group of serine, threonine, or tyrosine residues. The R-group for phosphoserine is shown at right. A) The image below is an Isoelectric focusing strip that shows the unphosphorylated protein-of-interest (in blue). To which side of the unphosphorylated protein would you expect to see the phosphorylated protein? (Draw an arrow to indicate direction). Briefly justify your answer. un-phosphorylatable: Low pH Justify: B) To study the effects of phosphorylation, researchers often mutate a Ser/Thr to appear as though it is always phosphorylated or never phosphorylated at a particular site. What amino acid substitution should you use to preserve similar dimensions as Ser (or Thr) but make the side chain appear to be: constitutively (always) phosphorylated: Justify: Ser or Thr → O O=P-O O I CH₂ Ser or Thr➜ Phosphoserine High pHA heptapeptide was found to have an amino acid composition of Asp, Leu, Lys, 2 Met, Phe and Tyr. (a) Trypsin has no effect on the heptapeptide. (b) The phenyl thiohydantoin released by Edman degradation revealed phenylalanine in the N-terminus. (c) Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The amino acid composition of the tetrapeptide was Leu, Lys, and Met. (d) Cyanogen bromide treatment yielded a dipeptide, a tetrapeptide, and free Lys. What is the amino acid sequence of this heptapeptide? Answer Format: (Three letter abbreviation with dash ie., Ala-Gly-…) *
- 8. NMR measurements have shown that poly-lysine is a random coil at pH 7 but becomes a helix when the pH is raised above 10. If the same type of folding behavior is observed, what should be the pH dependence of poly-glutamate? A) Helix at pH 7 but random coil at pH 10 B) Random coil at pH 3 but helix at pH 7 C) Random coil at pH 7 but helix at pH 10 D) Helix at pH 3 but random coil at pH 7The diagram to the right illustrates the inter-actions of the amino acid side chains of two a-helical polypeptide strands in a coiled-coil, viewed end-on and projected along the helix axes from the N-terminal to the C-terminal end. Are the macrodipoles of the two a- helices oriented parallel or anti-parallel? For this projec- tion is the positive end of the macro-dipole in the sur- face of the paper or below the surface? f C b g e d a' a d' g b' f'2.3 Manylendosomes become acidic because they have transporters in their membranes that pump H+ ions into the endosomal lumen. Which of the following statements is true? A) acidification of the endosomal lumen is critical for RNA vaccines because it increases the charge of the cationic lipids in the LNP's and thereby promotes fusion with cationic lipids in the endosomal membrane. B) RNAS are stabilized by high pH c) the pumping of H+ into the endosome likely requires energy from cellular ATP D) H+ catalyzes the conversion of pseudouridine into uridine, which is necessary before the MRNAS can be translated.
- 10. (a) Provide the scheme of Merrifield peptide synthesis with suitable example. (b) Describe the mechanism of action of the enzyme lysozyme.1. What are the effects of a) amino acid composition and sequence and b) intramolecular and intermolecular forces of attraction to protein folding? 2. What molecular property of amino acids can be used to justity the concept that the "molecular part of the protein can exhibit the same property as the molecular 'whole' (protein molecule?). Provide a comprehensive discussion using one molecular property. 3. Discuss two metabolic disorders which are caused by protein misfolding. Explain the metabolic consequence of the disorder. 4. If a non-science person asks you what protein folding is and how the concept is related to metabolic disorders, how are you going to explain the concept? (please summarize the concepts used, thank you!)Below is a picture of a molecule called StemRegenin-1 (SR-1) interacting with a polypeptide at positions A, B, and C. For position A, 1) describe the intramolecular force responsible for binding SR-1, and 2) suggest an amino acid that would provide the force you chose in part 1. B Blank # 1 Blank # 2