2. A single base addition and a single base deletion approximately 15 bases apart in the MRNA specifying the protein lysozyme for the bacterial virus T4 caused a change in the protein from its normal composition: Lys - Ser - Pro - Ser - Leu- Asn-Ala - Ala - Lys To the mutant form: Lys - Val- His- His- Leu- Met- Ala-Ala-Lys a. From the genetic code, decipher the sequence of mRNA for both original protein and double mutant. b. Which base was added? Which base was deleted? · END -
Q: 8. The following diagram represents the Christmas-tree-like structures during transcript On the…
A: E. Eliminators are viewed downstream of the quality as deciphered, and ordinarily happen…
Q: 1. For each of the following, explain how eukaryotic transcriptional initiation would be affected.…
A: According to bartleby expert guidelines, when multiple questions are posted we are allowed to answer…
Q: 2. The following figure represents the primary transcript of a typical eukaryotic protein-coding…
A: The given figure shows the presence of 3 exons and 2 introns. Exon 1 starts from bp 50 to bp 600.…
Q: 4. Apolipoprotein B is a protein that binds lipids and carries them around the body. One of the two…
A: The rate of translation varies amongst prokaryotes and eukaryotes. In prokaryotic cells, this rate…
Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…
A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…
Q: 1.The -glycosidic bond in uridine phosphate exist between a) C1 of ribose and N9 of uracil b) C3 of…
A: 1. The glycosidic linkage involves c-1 of sugar and the hydrogen atom of N-1 in uracil 2 Promoters…
Q: Select the correct statement(s) about transfer RNAs. Codon recognition occurs through specific…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…
A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…
Q: Explain why do eukaryotic mRNAs have to be “processed” whereas most prokaryotic RNAs do not?
A: Ribosomal and transfer RNAs are processed in both prokaryotes and eukaryotes. The processing of…
Q: 1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhvdrolvzed RNA,
A: RNA (ribonucleic acid) is a single chain polymer of nucleotides that is linked by phosphodiester…
Q: A single base addition and a single base deletion approximately 15 bases apart in the mRNA…
A: The DNA (deoxyribonucleic acid) is the hereditary material of an organism. The gene comprises the…
Q: All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The…
A: DNA replication, transcription, and translation are the molecular processes that are responsible for…
Q: 2. The following figure represents the primary transcript of a typical eukaryotic protein-coding…
A: Transcription in the process of synthesizing the mRNA by the action of RNA polymerase.
Q: 13. The following diagram shows the normal sequence of a particular protein, along with several…
A: Mutations are defined as the permanent alteration or change in the DNA sequence that makes up a…
Q: 2. What do you predict would happen if you created-a RNA with an anticodon of 5'-CAA-3' that is…
A: The translation of the proteins takes place as the mRNA having the codons are fitting into the…
Q: 3. You are investigating an abnormal eukaryotic cell line that makes mRNAs much longer than the…
A: mRNAs are single-stranded RNA molecules that are complementary to one of the DNA strands of a gene.…
Q: Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent…
A: According to bartleby expert guideline we are allowed to answer only one question. Kindly repost the…
Q: All of the following are functions of introns EXCEPT A. Provide buffering capacity against mutations…
A: Introns are non coding sections of RNA transcripts that are removed by splicing before the…
Q: Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the…
A: The protein is synthesized by the process of translation. It takes place in the cytoplasm of the…
Q: 7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant…
A: A mutation is a change in the nucleotide sequence of an organism's genome, virus, or…
Q: 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan…
A: Introduction Gene Regulation: Expression of gene is highly regulated in both prokaryotes as well as…
Q: 18. While studying a human patient with hemophilia, you have discovered that the second exon of the…
A: Transposable elements also are known as jumping genes. These are those DNA sequences that can change…
Q: (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in…
A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…
Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…
A: In this question we have to describe about regulation of genes . See full answer in step 2.
Q: If a mutation occurs in a coding region a. it will cause a change or changes in the normal…
A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…
Q: . Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous…
A: 1.Answer-- correct option is (b) Nucleotide excision repair
Q: Can you please answer number 24
A: Answer 24. Genetic code is a set of rules used by living cells to translate information encoded…
Q: Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a…
A: The DNA is transcribed into to an RNA by the process of transcription. Following the transcription…
Q: Gene expression in mammals can be increased by which of the following mechanisms? A. X-chromosome…
A: Gene expression The gene expression can be enhanced by activators. The activators increase the…
Q: 8. The following diagram represents the Christmas-tree-like structures during transcription. On the…
A: Introduction: A single nucleic acid strand has a backbone composed of repeating pentose-phosphate…
Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…
A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…
Q: 9. The following sequence is a wild-type bacterial gene that encodes a short protein. The sequence…
A: A) Lower Strand will act as template strand. B)5' ACUUCGAUAUGUCUAAAAUA 3'
Q: Do you think it matters which protein is mutated? Is one protein more important than another? How…
A: Exons and Introns are the regions of mRNA, while maturation of mRNA (splicing) the Exons are kept…
Q: The Shine Dalgarno sequence is ____________. located in the 50S subunit of ribosome. located on…
A: The correct option is (C) a sequence upstream of the AUG initiation codon on mRNA.
Q: 1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
A: 1.(a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: In the given diagram of splice donor site and acceptor site: - Splicing take place when a group of…
Q: 4. What is the nitrogen base pair of Adenine in transcription? * Cytosine O Uracil O guanine thymine…
A: Nucleic acid is biological macromolecules that is exhibited inside the nucleus is the cell. It…
Q: specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from ts…
A: INTRODUCTION Amino acids are the building blocks of proteins and nitrogenous backbones of…
Q: 2. How is RNA termination different in prokaryotes vs eukaryotes? Include an explanation of cis vs.…
A: The process of creating a copy of RNA (ribonucleic acid) of a gene sequence can be referred to as…
Q: RNA polymerases generally require a primer to begin transcription. (T) (F) The Death Cap…
A: As per the multiple questions policy, I am attempting the very first question posted by you. Kindly,…
Q: 2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type…
A: Reversion mutation is one that causes such a change in the gene that does not cause change in…
Q: 2) A few years ago, a graduate student in my lab realized that a DNA construct in which he fused the…
A: The recombinant fusion protein can be constructed using the component proteins and linker. The…
Q: 1. What happens during transcription? Possible sentence frame: Transcription is the process in which…
A: Need to fill the blanks related to transcription process.
Q: An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single…
A: Genetic code is read in the form of triplets.so first we will convert these to 3 codes and then…
Q: 1. a)What are the two types of ncRNA used in translation? b.) How is translation terminated when…
A: Translation is the phenomenon in which the ribosomes present in the cytoplasm carry out the process…
Q: 12. The following codons and the amino acids they encode is as follows: AUG = Met %3D UUU, UUC = Phe…
A: ANSWER;- a) The sequence of amino acids in the following structure Met-Phe-Leu-Ser-Thr-Pro b)(i) DNA…
Q: double-stranded RNA
A: ribonuclease III family Enzymes from the ribonuclease III family bind and cleave…
Q: 3. Why do Class I DNA based transposable elements have terminal inverted repeats?
A: Transposable elements also known as transposons as well as jumping gene. As the name suggests it is…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition= lys-ser-pro-ser-leu-asn-ala-ala-lys mutant form= lys-val-his-his-leu-met-ala-ala-lys. Decipher the segment of mRNA for both the original protein and the double mutant. Which base was added? Which was deleted?BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple41. The following 9 TRNAS have anticodon loop regions that base pair with the mRNA in the ribosome. Using your knowledge of tRNA-MRNA base pairing and the genetic code chart (+lecture slides), indicate the MRNA codon message being read by the ribosome as well as the1-letter amino acids that is generated. Anticodon Anticodon Anticodon Anticodon 4 Anticodon Anticodon 6. 2 5'-IAG-3' 5'-UAU-3' 5'-АAА-3' 5'-CUC-3' 5'-GAU-3' 5'-AGA-3' codon MRNA 5'-__-3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 1 letter amino acid Anticodon Anticodon Anticodon 8 7 5'-CCG-3' 5'-GUU-3' 5'-CGC-3' codon 5'-__-3' 5' 3' 5' _3' mRNA 1 letter amino acid
- oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCCA single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wild-type composition...lys-ser-pro-ser-leu-asn-ala-ala-lys....to the lys-val-his-his-leu-met-ala-ala-lys. a. Decipher the segment of MRNA for both the original protein and the double mutant. mutant form b. Which base was added? Which was deleted?48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-ArgExplain what is meant by the concept of "central dogma of molecular biology". Name the main processes involved in this dogma and highlight the roles of the different types of RNA molecules involved in them. Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA…
- Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9…Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…