1. Based on the results obtained give the differences between the hydrolyzed and unhvdrolvzed RNA,

1.- Outline the general process of transcription (dna->rna) include a diagram a) include the basic enzymes involved and a description of their actions b) what is the product of transcription c)what will the cell do with the product d)where does the transcription take place in prokaryotic cell

1. Suppose a protein sample with a fragment containing the following amino acid sequence is subjected to various chemical assay/tests. - Ala-Gly-Trp-Phe-Met-Cys-    What is observed when the protein sample is subjected to Millon’s test? Violet interface       Red precipitate/solution       Brown/black precipitate       Yelllow product       No observable result 2. Suppose a protein sample with a fragment containing the following amino acid sequence is subjected to various chemical assay/tests. - Ala-Tyr-Trp-Phe-Cys-Gly -           What is observed when the protein sample is subjected to lead sulfide test? Violet interface       Red precipitate/solution       Brown/black precipitate       Yelllow product       No observable result

3. In future lectures we will describe a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. Briefly, in this method a specific RNA is detected using a short segment of cloned DNA as a probe. The DNA probe, which is radioactive, is complementary to the RNA that the researcher wishes to detect. After the radioactive probe DNA basepairs to the RNA, the RNA is visualized as a dark (radioactive) band on an X-ray film. As shown here, the method of Northern blotting can be used to determine the amount of a particular RNA transcribed in a given cell type. If one type of cell produces twice as much of a particular mRNA as occurs in another cell, the band will appear twice as intense. Also, the method can distinguish if alternative RNA splicing has occurred to produce an RNA that has a different molecular mass. 875 nucleotides 675 nucleotides 1 Northern blot 2 - 3 Lane 1 is a sample of RNA isolated from nerve cells. Lane 2 is a sample of RNA…

4

9. (ai Diagrammaticaliy describe transcription using as a blueprina for MRNA with ciear depiction of the informational and anti- sense strands. Also, provide the direction of transcription (Explanation is not Eguired)

15. Describe the mechanism of RNA polymerase. What is the nucleophile? What is the leaving group? What role does Mg play?

4. For the gene drawn below, transcription begins at the boxed A/T base pair. a. Identify the promoter, template and coding strand. b. Transcribe c. Translate 5'- TTGGAATTGTGAATGGATAACAATGTGACACAGGAAACAGCTAAGTAGATGTTT -3' 1 54 3'- AACCTTAACACTTACCTATTGTTACACTGTGTCCTTTGACGATTCATCTACAAA -5' ---+--- ---+--- ---+---- ---+--- ---+---

6