22. Some tRNAs contain inosine, which can base pair with A, C, and U. Why might this be advantageous with ate but not ambiguous? olyp min 33. What is required for molecular surfaces/interfaces to interact with one another for a sufficient amount of time (such as an antibody/antigen)?

22. Some tRNAs contain inosine, which can base pair with A, C, and U. Why might this be advantageous with ate but not ambiguous? olyp min 33. What is required for molecular surfaces/interfaces to interact with one another for a sufficient amount of time (such as an antibody/antigen)?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: 18. Chaperones are frequently associated with polypeptides as they are being synthesized from the…

A: Chaperons are proteins that are primarily concerned with protein folding. It prevents the…

Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…

A: Mitochondrial tRNA in humans has gained interest due to the discovery of associations between point…

Q: A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different…

A: The given peptide sequences are: CNBr 1: Gly-Thr-Lys-Ala-Glu CNBr 2: Ser-Met Tryp 1:…

Q: Q1. Considering how readily RNA folds to form secondary structure, why isn't it used to store…

A: RNA has several functions in biological operations, and our understanding of its significance is…

Q: What anticodon sequences of tRNAs are coded for by the mRNA codons below? (Enter each sequence in 5'…

A: An mRNA molecule's complementary sequence forms a binding with the three nucleotides that make up…

Q: The unfinished peptide Met-Arg-Ser-Tyr-Gln-Cys-Pro is held in the P-site of the 708 ribosomal…

A: The process of synthesis of protein based on the information carried by mRNA is called translation.…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: What molecules thought to have performed double duty as a genetic materal and performing catalyss of…

A: Any material of plant, animal or other origin that carries genetic information from one generation…

Q: Wild-type Mutant 1 Mutant 2 Mutant 3 Stop silent DNA 3 CTT 5 5 3 5 Val missense 3CTC 5 5 GAG 3 mRNA…

A: The genetic code is the set of rules used by living cells to translate information encoded within…

Q: deu suoi op MOH

A: Q 1. DNA is the main genetic material, it is made up of polynucleotide. Mutation can be defined as…

Q: 6. Please describe the events that may result in a mature protein not having methionine as the…

A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…

Q: 4. Match the terms on the left with those on the right: AUG dihydrouridine Esite

A: Above given in the match the following are the terms involved in the translation process studied in…

Q: 2. A molecule of tRNA with the anticodon 5'-ACC-3' will transport the amino acid the tRNA and the…

A: The genome is the genetic material of an organism that is passed down to its descendants and can be…

Q: (a) () The isoelectric point (pl) of the protein, i.e., the pH at which the overall electrostatic…

A: The isoelectric point (pI) is the pH of a solution at which a given protein has a net charge of…

Q: Discuss the general structure of the carrier proteins within our cells. Describe how their structure…

A: Integral membrane proteins called carrier proteins make it easier for molecules to penetrate cell…

Q: . What is wobble base-pairing? According to Wobble's rule, one tRNA is sufficient to decode the…

A: Base pair is defined as two complementary nitrogenous that are connected by hydrogen bonds. Base…

Q: N-terminal region variable sequence C-terminal region of

A: Introduction: Cytosolic N terminal region meant it is extended towards the cytosol. The membrane…

Q: Finish the translation story: - fully explain the G factor stories for each step – and the…

A: Translation Theory: Translation is a biological process that occurs in cells, whereby genetic…

Q: Here is the amino acid sequence of part of a hypothetical gene you want to clone:…

A: a.The amino acid sequence Tyr-Met-Cys-Trp-Ile will make a 14-mer probe with the least degeneracy as…

Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…

A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…

Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…

A: The genetic material has various components on which the transcriptional and translational machinery…

Q: Match the function with the appropriate protein or sequence:

A: tRNA is a short nucleotide chain with L-shaped structure. A tRNA molecule is required for…

Q: what would happen to kcat and km if a lysine was was changed to a arginine in a SK dyad?

A: Serine proteases are enzymes with a serine, a histidine and an aspartate residue in its active site…

Q: 33. Band 3 protein exists as a 95-kDa multipass membrane protein that functions as the primary anion…

A: Given, Band 3 protein ,a protein which is essential for RBC membrane support and also acts…

Q: Some tRNAs can recognize more than one codon because there is a relaxation of the complementation…

A: Translation of mRNA into protein requires a specialized adapter molecule called tRNA and ribosomes.…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: Describe how the two (or more) binding events and structural change relates to the overall function…

A: * Proteins are made by linkage of amino acids together with each protein having a characteristic and…

Q: 1 Foundations Cell Molec The first 17 amino acyl residues in human preproinsulin are…

A: Colinearity simply refers to the relationship between the length of a DNA sequence in a gene and the…

Q: Why is denaturing the proteins necessary for SDS PAGE to work? Use YOUR OWN BERITEL

A: Introduction Proteins are large, complex molecules that perform a wide range of essential functions…

Q: b) How does accuracy of aminoacylation during tRNA charging regulated to ensure fidelity of genetic…

A: Answer. The fidelity of protein synthesis depends on the accuracy of the two mechanisms: The linking…

Q: 25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: What type of DNA structure is recognized by RecG and RuvABC?Do you think these proteins recognize…

A: Deoxyribonucleic acid (DNA) is a genetic material of most organisms. DNA contains the instructions…

Q: What is the function of: D loop - Anticodon Loop- TC Loop- acceptor stem-

A: The term tRNA stands for transfer RNA. tRNAs are small, generally having less than 100 nucleotides.…

Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…

A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this…

A: Transcription is the process of the synthesis of mRNA from a DNA. This process occurs in the nucleus…

Q: What item/s are true? 1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND…

A: DNA and RNA are important for cell function as DNA provide the information for the cell's…

Q: 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the…

A: Introduction DNA (Deoxyribonucleic acid) sequence is the order of nucleotide bases (adenine,…

Q: A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose…

A: Proteins are formed of peptide bonds formed between the amine group and the carboxyl group of the…

Q: PPPP 2.7 essage hatentaded pruteiis? gene iS shown below (starting with ATG), What is the resulting…

A: We are authorized to answer one question at a time since you have not mentioned which question…

Q: Wobble base pairing allows some tRNAs to bind to more than one type of codon. If wobble base pairing…

A: Francis crick proposed the wobble hypothesis in 1966. According to which : The 5' end of anti-codon…

Question

22. Some tRNAs contain inosine, which can base pair with A, C, and U. Why might this be advantageous with
ate but not ambiguous?
olyp
min
33. What is required for molecular surfaces/interfaces to interact with one another for a sufficient amount of
time (such as an antibody/antigen)?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

What are two possible anticodon sequences for tRNA's that are charged with Phenylalanine (Phe)? O 3' AAU 5' and 3' GAA 5' O 3' AAA 5' and 3' AAG 5 3' UUG 5' and 3' CUG 5' O 3' GAA 5' and 3' CAG 5' 3' GUA 5' and 3' GUG 5'
E21.
Explore: Codons Found in Messenger RNA Second Base U C A Cys u Cys c Stop A G Phe Ser Tyr Tyr Stop Stop His Phe Ser Leu Ser Leu Ser Trp Leu Pro Arg Arg Arg G Leu Pro His Leu Pro Gin Leu Pro Gln Arg le Thr Asn Ser U A lle Thr Asn Ser le Thr A Lys Lys Arg Arg Gly Gly A Met Thr Val Ala Asp Val G Val Ala Asp Glu Ala Gly Gly Val Ala Glu Mutation #1: • Change the Mutation to RED Original DNA Sequence: TACAC CTTGG CCGACGACT mRNA Sequence: A UGUG GA ACCG CUG C UGA Amino Acid Sequence: MET -TRP- ASN - ARG- CYS - (STOP) Mutated TAC ATC TTG GCG ACG ACT DNA mRNA AUG Amino Acid МЕТ- MET - Will this mutation have an effect? What kind of mutation is this? First Base Third Base
. What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons?
5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
9. Shown below is a binding pocket for a protein with a ligand bound. The ligand interacts with a serine and a valine side chain. ligand a. Briefly explain, in terms of Ka, the effect of a mutation that replaces the serine residue with a valine residue. b. Briefly explain, in terms of Kd, the effect of a mutation that alters the ligand (as seen below) binding to the original, unmutated, binding site. :0: ligand 2
Give me a clear Explanation Detailed Solution..no need handwritten
51 23. Suppose that a mutation occurs in the DNA sequence (indicated by a red nucleotide). 5 ATG GGA CCC CAT TCC GCC AAG GGG CAC TGA 3' 3 TAC CCT GGG GTA AGG CGG TTC CCC GTG ACT 5' Type the RNA sequence that would be produced by this template: 3′
Question 6 Review after transcription modification. Match the term and its description. Each term can only be used once. catalytic RNA molecules that function as enzymes | Choose ) Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during splicing [ Choose ) Proteins often have a modular architecture consisting of discrete regions | Choose J >
Discuss how considering 'allylic strain' can explain the favoured conformation of alanine in the tripeptide Ala-Met-Thr, and how this is relevant to the B-sheet conformation in peptides/proteins.
Please quickly
Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro in