Q: 5. Consider eukaryotic transcription: a) Draw a eukaryotic gene and label key sequences. (5 points)
A: A eukaryotic gene, consists of a set of sequences that appear in mature mRNA interrupted by introns.…
Q: 3. An alteration of genetic information is shown below. A-G-T-A-C-C-G-A-T → A-G-T-G-A-T What type of…
A: Alteration of genetic information shown below is an example of Deletion Mutation. In the given…
Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…
A: The protein synthesis occurs in cytoplasm by the process of translation.
Q: 2. Complete the leading strand and the complementary strand with the 5'and 3' ends and identify the…
A: DNA acts as the genetic material in most of the organisms present on earth. DNA is first transcribed…
Q: 1c. Write in the specific ANTICODON and the specific AMINO ACID in the boxe This image on the right…
A: tRNA is called as transfer RNA and helps in transfer of information from the mRNA to protein (…
Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…
A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…
Q: 7. How many different mRNAs could specify the amino acid sequence met-phe-ser-pro? 8. Agene contains…
A: Ans 7: Genetic codes are triplet in nature. Genetic codons are degenerate in nature, which means,…
Q: 1. What is the concept of universality of the genetic code? What are the exceptions to this…
A: Introduction The sequence of nucleotides on m-RNA that code for an amino acid is known as genetic…
Q: Write the mRNA sequence that remains after the deletion. Use the codon table to write the sequence…
A:
Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…
A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…
Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF
A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…
Q: What codons are found in the mRNA for the two mutated DNA
A: 1. The cell reads the sequence of the gene in groups of three bases. There are 64 different codons:…
Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…
Q: 1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of…
A: Introduction: The changes or alteration in the sequence of DNA is known as mutation.
Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?
A: DNA is the store house of genetic information. This genetic information expressed by the formation…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: 6. The DNA sequence of a portion of the TEMPLATE strand of a gene is 5'-CAATACGTAC-3'. A. Write the…
A: The Central Dogma theory, in Genetics, states that DNA makes DNA through Replication. DNA makes RNA…
Q: 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time…
A: Answer : Given in the image
Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…
A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…
Q: 1. Using the central dogma of molecular biology, explain the terms replication, transcription and…
A: Since you have asked multiple questions, we will answer only the first question for you. If you want…
Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…
A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…
Q: What codons ar e found in the mRNA for the two mutated DNA?
A: Answer 1: - There are 14 codons in the original DNA sequence. Answer 2:- Similarly, there are 14…
Q: 7. Look at 6a and 6b. Compare the RNA sequences and the polypeptide sequences they code for. What…
A: A base pair is two nucleotides that together constitute a DNA ladder." A DNA nucleotide is composed…
Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…
A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…
Q: What are the components of the initiation complex for translation
A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…
Q: 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…
A: Introduction: The process of copying the genetic information from one strand of the DNA into RNA is…
Q: What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC d. GAT e.…
A: A genetic codon is a triplet nucleotide sequence of RNA molecules that were formed from the…
Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…
A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…
Q: Compare the structure and functions of DNA nad RNA.
A: Nucleic acids DNA RNA DNA : Deoxyribonucleic acid : It is long chain polymer of two…
Q: 6. If you are given the DNA sequence: T-A-C-C-G-A-A-T determine the complementary RNA strand.
A: Introduction :- The term "DNA sequencing" refers to a common laboratory procedure for determining…
Q: 2. If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…
A: Answer :- Option (A) is correct. - 3.
Q: 3. What is meant by the term histone code? With regard to gene regulation, what is the proposed role…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Discuss the difference between intron and Exon
A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…
Q: 6. What are the similarities and differences between the transcription process and the replication…
A: Replication A biological process of in which two identical copies of DNA are produced.
Q: 4. Discuss and detail reasons why eukaryotic organisms appear to have more DNA than is necessary to…
A: The coding sequences of Eukaryotic DNA is called exon and the non coding sequence of Eukaryotic DNA…
Q: 1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction…
A: In a transcription unit; the there are 2 DNA strands. The strand with polarity 3' to 5' is the…
Q: 2. How is RNA termination different in prokaryotes vs eukaryotes? Include an explanation of cis vs.…
A: The process of creating a copy of RNA (ribonucleic acid) of a gene sequence can be referred to as…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The central dogma of life involves three processes. They are: Replication: - In this process,…
Q: 6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA-…
A: For the expression of a gene, the nucleotide sequences present in the template strand of DNA are…
Q: 1. a)What are the two types of ncRNA used in translation? b.) How is translation terminated when…
A: Translation is the phenomenon in which the ribosomes present in the cytoplasm carry out the process…
Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…
A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…
Q: 1. What are the three RNA processings in eukaryotic cells?
A: RNA processing is the term collectively used to describe the sequence of events through which the…
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
Q: )Which of the following statements are true? Choose all that apply a)There are multiple codons…
A: The DNA expression involves the protein synthesis which involves a series of events primarily the…
Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…
A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…
Step by step
Solved in 2 steps
- 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine (le), Arginine (Arg), Tryptophan (Trp).1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the anticodon in tRNA is CUU, what is the complementary codon? 3. How many synonyms code for arginine? 4. How many codons code for the amino acid cysteine? 5. How many codons code for the amino acid histidine? 6. How many codons code for the amino acid threonine?2. The 64 codons are shown in Table 1. Notice that the first two nucleotides of each codon (abbreviated by their first letter) are shown in the column on the left. To find out the amino acid specified by a given codon, find the first two letters in the column on the left, then follow that row to the column showing the last nucleotide (letter) of the codon. Note that most amino acids are coded for by more than one codon. Table 1. The Genetic Code: Codons and Their Amino Acids First Two Mocleotides af Codons Last Nocleotide of Codons A The Amino Acids phe phe leu leu Abbreviations Names UC gly glycine alanine ser ser ser ser ala UA tyr tyr term term val valine UG cys cys term trp ile isoleucine cu leu leu leu leu leu leucine serine threonine ser CC pro pro pro pro thr gin proline aspartate glutamate lysine arginine asparagine glutamine cysteine methionine CA his his gin pro asp CG arg arg arg arg glu lys AU ile ile ile met AC thr thr thr thr arg asn AA asn asn lys lys gln AG ser ser arg…
- 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?1. If a single transition occurs in a codon that specifies Phe. List all the possible mutated codons and the amino acids they specify.16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U C A G UUU UUC- UUA UUG- H₂N+ H H₂N-C- Phe (F) CUU- CCU CUC CCC CUA CCA CUG- CCG AUU ACU AUC Ile (1) ACC AUA ACA AUG Met (M) start ACG- GUU GCU GUC GCC GUA GCA GUG- GCG Nonpolar side chains; hydrophobic Leu (L) U Side chain (R group) OH CH₂ Leu (L) H₂N-C Val (V) HO Glycine (Gly or G) CH3 S CH₂ CH₂ Polar side chains; hydrophilic H O Methionine (Met or M) 0 H₂N-C Second base in codon UCU UCC UCA UCG OH CH, CH HO Aspartic acid (Asp or D) HO Alanine (Ala or A) 0 H O Serine (Ser or S) HO Threonine (Thr or T) Electrically charged side chains; hydrophilic CH3 H₂N-C-C-0- Acidic (negatively charged) CH₂ H₂N+ C CH₂ CH₂ H₂N-C-C-0- H₂N-C- C CH₂ Ser (S) Pro (P) Thr (T) H O…
- 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U A UUU UUC- UUA UUG- CUU CUC CUA CUG- AUU- ACU AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU GUC GCC GUA GCA GUG- GCG H₂N- U Phe (F) Leu (L) Leu (L) Nonpolar side chains; hydrophobic Val (V) Side chain (R group) H H₂N-C-C-0- HO Glycine (Gly or G) CH₂ H₂N*- CH₂ CH₂ H O Methionine (Met or M) Polar side chains; hydrophilic 0 CH₂ Second base in codon H O Aspartic acid (Asp or D) UCU UCC UCA UCG CCU CCC CCA CCG Alanine (Ala or A) OH CH₂ H₂N-C C 0 H₂N-C C 0 H O Serine (Ser or S) H O Threonine (Thr or T) Electrically charged side chains; hydrophilic OH CH3 CH -0- H₂N+- Acidic (negatively charged) CH₂ H₂N-C-C-O HO C Ser (S) Pro (P) CH₂ CH₂ Thr (T) CH₂ H₂N-C Ala (A)…12. The following codons and the amino acids they encode is as follows: AUG = Met UUU, UUC = Phe UUA, UUG = Leu UCU, UCC = Ser CCU, CCC = Pro ACU, ACC = Thr %3D %3D The 5' - ACU-UUC-ACU-AUG-UUU-UUA-UCC-UCC-ACU-CCU-UGA-3' MRNA transcript results in a polypeptide. (a) Give the sequence of amino acids in the primary structure of the polypeptide. (3) (b) Give the sequence of nucleotides corresponding to this transcript in: (i) the DNA strand that was read to produce the MRNA (5) (ii) the DNA strand that was NOT read (the coding strand) (5) (c) How many distinct aminoacyl-tRNA synthetases would be used in the synthesis of this polypeptide? (1) (d) Name TWO characteristics of the genetic code that are evident in the data given in the question. (2)13. The codon for the amino acid methionine (met) is AUG. What is the corresponding anticodon found on the tRNA that carries the methionine amino acid?
- 4. Mark the following statements about the genetic code as TRUE or FALSE: The genetic code is completely universal. One amino acid can be specified by more than one codon. Each codon can specify multiple amino acids. Each codon is 3 nucleotides long, yielding 64 different codons. There are three different "stop" codons each coding for a termination amino acid. For each false statement in # 4, explain why it is false.1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the following nucleotide sequence. Give the primary structure of the polypeptide (use 3-letter amino acid codes), beginning with the most common translation initiation codon, that will be specified by this portion of the gene. Be sure to label the ends of the polypeptide. 3'-TTTTACGGGAATTAGAGTCGCAGGATG-5'1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction of the sequence. The resulting sequence is given, but without the 3' or 5' ends identified. NOTE the sequence listed is double stranded. (a) Find all START codons (in both directions and for both strands) and report the sequence of the two start codon(s) plus the next 3 bases downstream (i.e. 5' to 3' direction) (b) One of the start codons has a STOP codon 5 codons downstream, list the 18 bases that contain the target sequence and the 6 amino acids that this (very short) open reading frame would translate to (c) BONUS: Identify the 3' or 5' ends for lables1- 4 (1) ATATTAAAAAAGGTTTAGGTACGGAACGTCGAAGAGAACTAAACACAAATTAAGTGACAGACAGTTGTC (2) (3) TATAATTTTTTCCAAATCCATGCCTTGCAGCTTCTCTTGATTTGTGTTTAATTCACTGTCTGTCTACAG(4)