A ALEKS - Julianna Graham - Lex ← -> C + www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-lgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9QIC2eximg3llf4UgzRAfAEs Bjuj6RDc7Yrn0JQE5NIn-2CENI_Mk.... Biological Macromolecules Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: ATGAGGTTATAG It's known that a very small gene is contained in this section. In the table below, write the base sequence for two point mutations of this DNA, one silent, and one not. Silent mutation: Non-silent mutation: Explanation Check MacBook Air 0/5 Julianna 5 ala 2024 McGraw Hill LLC. All Rights Reserved. Terms of Use Privacy Center | Accessibility Σ

Q: Use the survivorship curve graph to answer questions 19-20. (Extra Credit!) 100 A 10 0.1 100 50…

A: As per our guidelines we are supposed to answer only ? One question ( if there are multiple…

Q: Fluorescent FM dyes partition reversibly into biological membranes without penetrating through them.…

A: Synaptic regions in neurons refer to the specialized areas where synapses are formed. Synapses are…

Q: 39) stored energy. is (are) the most abundant form of fats in our body and is (are) a good source of…

A: Fats and carbohydrates are two important biomolecules in the body . They have different but very…

Q: please choose statements/concepts that relate to SCIENCE that begins with letter X X letter should…

A: As we know that science is the study of knowledge , technologies based on experiments. There are…

Q: heritance/ 10 of 15 Sickle cell anemia is an autosomal recessive disorder. If each parent carries…

A: Ans- Sickle cell anemia is an autosomal recessive disease that result in the body to produce…

Q: Before a cell divides, it duplicates its DNA in a process called molecule unzips into two strands…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Administration of a drug which inhibits norepinephrine synthesis is expected to: O Decrease insulin…

A: Hi! Thank you for your question. As you have posted multiple questions and have not mentioned which…

Q: Part A Describe the three types of transmission-based precautions recommended by the Centers for…

A: When standard precautions alone do not completely prevent communicable disease transmission,…

Q: A method that forces an occupied office to be refilled is called the: initiative dissent petition O…

A: Recall in memory refers to the mental process of retrieval of information from the past.

Q: ubin looking for 2. A) In a museum exhibit B) In an anatomy 3. Where are some of the best roadmaps…

A: 1. Option C. 2. Option C. 3. Option B. 4. Option B. 5. Option B. 6. Option TRUE. 7. Option C. 8.…

Q: Please identify the name of human chronic disease in the below figure and what are the dietary cause…

A: Answer:  CHRONIC DISEASES : It is the condition in the human body in which a disease can persist for…

Q: could you make powerpoint presentation subtopics for Fluorescent Protein-Based Biosensors and Their…

A: In live-cell mechano transduction imaging and mechano pharmacological drug screening, biosensors…

Q: esc A ALEKS-Julianna Graham - L x 5 Grades for Julianna Graham: C…

A: The molecules in the image are all aldoses, a type of monosaccharide with an aldehyde functional…

Q: for an in vitro translation reaction. Which one would you leave out? Cell sap containing ribosomes O…

A: In vitro translation is a technique that in which a given mRNA is translated (outide the cell using…

Q: DON'T CANCEL I WILL UPVOTE LETTER M please choose statements/concepts that relate to SCIENCE that…

A: Cells are the structural units of living beings. Cells have organelles for proper functioning of…

Q: Paragraph Styles Edit Deafness in Cocker Spaniels is inherited. The allele for deafness is recessive…

A: It is given that deafness is a recessive trait and given by d while normal hearing is dominant given…

Q: 3 Website 2: What are DNA and Genes? http://learn.genetics.utah.edu/content/basics/dna/ 6. DNA is…

A: The DNA or deoxyribonucleic acid is the genetic material of living organisms that contain genes. The…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…

A: According to Bartleby guidelines, the first three subparts have been answered kindly post the…

Q: 1. If you crossed two plants from the F, generation, what procedure would you follow to determine…

A: Please find answer in step2

Q: xzwVueNpTMZTzyoxUip3DQ/viewiorm?hr_submission=Chkir-XdhqEFEhAl-6F Which of the following does NOT…

A: Depolarization in action potential is defined as a change in the membrane potential of a cell to a…

Q: What are algal blooms, what impact can they have on aquatic ecosystems, and what can be done to…

A: Algal blooms occur when colonies of algae grow out of control and produce toxic effects on living…

Q: IWo students are plani espu environments. They will conduct two investigations-one that tests the…

A: Planarian ( Aquatic flatworms ) -- Planarian aquatic flat worms are organisms of order Tricladida ,…

Q: Instead of Thymine, RNA uses

A: Nucleic acids are made up of 4 nucleotide molecules as there are four nitrogenous bases.DNA or…

Q: Paragraph Styles Text-dependent Questions Use quotes from the text or summarize the text in your own…

A: All eukaryotic cells have many organelles. Some of them are double membrane bound. Ex -…

Q: (S8.2) Which of the following are needed for natural selection to take place?

A: Natural selection is a theory proposed by Charles darwin. From his theory, we can understand that…

Q: 4. The diagram illustrates the activity of vesicles during a cellular process. Which statement best…

A: Golgi body use to release the vesicles which contain the material of the cell. The main function of…

Q: How many unique polypeptides would you expect to see synthesized by an in vitro translation reaction…

A: The correct answer is Option B - 1 According to the question, the mRNA code is poly (AC)n This…

Q: End

A: In anatomy, the head portion is known as the cephalic region consisting of all the head regions.…

Q: Answer asap pleade

A: Introduction:-  Insulin is hormone secreted from the the beta cells of pancreas. It action is when…

Q: Which statement best describes an exponential model of population growth? it assumes that the…

A: The population is the group of organisms that belong to the same species and live together in a…

Q: NAME: Grade and Section: HEALTH 8: 3RD QUARTER: WEEK 2-3 Let's Apply Instruction: Answer the…

A: Communicable disease means a disease that spreads from one person to another through direct or…

Q: ARS 8å, DOR 2) Which of the following are potential therapeuticC uses of embryonic stem cells? O A.…

A: Regeneration implies the re-growth of a portion of the affected or lost organs of the remaining…

Q: Thursday 2/23/2023 Assignmer X ZUHAIB VARIYAVA-Task 2: Ben x b Answered: Why do identical twin x +…

A: Introduction :- Identical twins, also known as monozygotic twins, share the same DNA since they…

Q: What happens when you get food poisoning or the flu? How does our body fight an infection when we…

A: Symptoms like nausea, vomiting, diarrhea caused due to consumption of toxic or rotten food, this…

Q: 36/variants/3043936/take/11/ TEXT ANSWER Use at least three anatomical terms to describe the…

A: Our body has main skeleton ( axial skeleton) and appendicular skeleton. Axial skeleton consists of…

Q: Font Paragraph Drawing Editing 1. How many chromosomes? 2. Describe the abnormal chromosome 3. What…

A: Mutation is a process by which the genetic material (DNA) of an organism is altered. It can be a…

Q: Consider the mRNA sequence below. Assume that the following MRNA segment has been translated.…

A: Genetics is the branch of biology that deals with the study of genes, their variation, and heredity…

Q: Four cars of different masses are moving on the same road at the same speed. The mass of each car is…

A: Answer: Option is Car C

Q: Styles Editing In cattle, the RR genotype calls for a red cow; the WW for a white cow; and the RW…

A: We are answering first question only. For rest of questions pls Repost.

Q: +…

A: To determine the base sequences for a silent mutation and a non-silent (or missense) mutation in the…

Q: V5 Strip Number 1: Regularity - Rate- P wave Present --Y or N = Y PRI - QRS - Interpretation - Place…

A: Note : Hi. Thanks for your question. Since you have posted question with multiple subparts. We will…

Q: What is the primary source of carbohydrates for humans? Name one type of food that you eat that…

A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, typically…

Q: Question 3 Damage associated molecular patterns (DAMPs) found on microbes self-structures microbes…

A: As per bartleby guidelines only 3 questions can be answered. Please post remaining questions…

Q: The name of the protein and its function in yeast. What effect the protein has on the function of…

A: Yfh1 gene form frataxin homolog protien It helps in storing protein in it and form iron sulphur…

Q: ms/d/e/1FAlpatseg The secretes a hormone that increases the body's metabolic rate, promotes…

A: Nodes of ranvier are specialised regions in axon. They are not insulated by myelin.

Q: The term 'transcriptome' for a given neuron refers to: all vesicles currently transcribed from the…

A: The production of RNA from DNA is known as transcription that occurs within the cytoplasm of…