7. Draw a tRNA that would recognize the codon 5' A U G3'. What is the sequence of this tRNA's anticodon? Labelthe ends of the tRNA (3' and 5'). Label the anticodon inyour diagram, and write out the sequence of the anticodonin the context of your figure. Where is the amino acidattached? What type of bonds will form between theanticodon of the tRNA and the mRNA codon?8. How has the mutation altered the polypeptide? Is thefunction of the hemoglobin molecule (which includes 2 b-globin polypeptides and 2 a-globin polypeptides) impaired?(Read your book to learn more about sickle cell disease.)9. What is the relationship between the genotype in thiscase and the individual's phenotype?

Name: 7. Draw a tRNA that would recognize the codon 5' A U G3'. What is the
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 7. Draw a tRNA that would recognize the codon 5' A U G3'. What is the sequence of this tRNA's anticodon? Labelthe ends of the tRNA (3' and 5'). Label the anticodon inyour diagram, and write out the sequence of the anticodonin the context of your fig

As per the guidelines we are supposed to answer only the first question in case of multiple question…

Science

Biology

7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's anticodon? Label the ends of the tRNA (3' and 5'). Label the anticodon in your diagram, and write out the sequence of the anticodon in the context of your figure. Where is the amino acid attached? What type of bonds will form between the anticodon of the tRNA and the mRNA codon?

7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's anticodon? Label the ends of the tRNA (3' and 5'). Label the anticodon in your diagram, and write out the sequence of the anticodon in the context of your figure. Where is the amino acid attached? What type of bonds will form between the anticodon of the tRNA and the mRNA codon?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2CT

See similar textbooks

Similar questions

From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
1e) Give the sequence of every codon this tRNA, with the anticodon 5'AGG3', could base pair with (perfect and wobble matches), and name the amino acid coded for by each codon whose sequence you have written.
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
Draw a tRNA that would recognize the codon 5’ A U G 3’. What is the sequence of this tRNA’s anticodon? Label the ends of the tRNA (3’ and 5’). Label the anticodon in your diagram, and write out the sequence of the anticodon in the context of your figure. Where is the amino acid attached? What type of bonds will form between the anticodon of the tRNA and the mRNA codon?
6) Proline is not commonly found in the middle of a-helices because its ring structure prevents it from adopting the proper value and because it disrupts the hydrogen-bonding pattern of the helix. Looking at the structure of proline in the amino acid sequence below, suggest how this residue would disrupt the hydrogen-bonding pattern of an a-helix. 'N H R N N H *** R
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?
3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may be some ambiguity for the last codon with regards to the amino acid possibilities) if the translation frame had UCA as the first codon: if the translation frame had CAA as the first codon: if the translation frame had AAT as the first codon:
Write the names of the appropriate regions on L-shaped structure of TRNAS. 13'
1)If we were to begin with protein that is 145 residues long, How many (ATP/GTP) would have to be used? (ATP hydrolysis from 1 pyrophosphate= 2 ATP)' 2)What is the corresponding codon of an anticodon GUA (ignoring the wobble).
Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter