Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Describe how the two (or more) binding events and structural change relates to the overall function of the protein(uniprotkb-39086). Explain what specific information is communicated as it relates to the function of the protein within the cell.
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The activity provides you with a version of the NGF pathway, an example of a RTK. All of the proteins involved can be in ON/OFF states. Using this cell signaling pathway you will be asked a variety of questions to determine how the molecules are regulated, but also how a cell would respond if this cell signaling party steps were interrupted or activated. Neural Growth Factir (NGF) Ras- Ras- GDP GTP Trk-A Ras-GEF braf braf МЕК МЕК ERK ERK ERK ERK STAT STAT Spiouty DNA Nucleus Cytosolarrow_forwardDescribe the function of the Bicoid protein. Explain how its ability to exert its effects in a concentration-dependent manner is a critical feature of its function.arrow_forwardA. What change should disrupt the interaction between proteins 1 and 2 the most? Why? B. What change would disrupt the interaction between proteins 1 and 2 the least? Why?arrow_forward
- How can widely separated parts of a protein interact with the spike protein? Give two reasonsarrow_forwardThe elegance and importance of proper protein folding and assembly cannot be overstated. Simple electrostatic interactions are fully responsible for long peptide chains becoming giant, globular, functional proteins. Research and discuss two examples of improper protein folding. What is the cause of each malformed protein? What is the consequence of this deformity? What are potential treatment options, and how do they address and remedy the problem?arrow_forwardDescribe how a carrier protein functions. What role do carrier proteins serve in the cell? Why are they necessary? Where might you find a carrier protein?arrow_forward
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?arrow_forwardWhat are the four types of protein modification and their descriptionsarrow_forwardWhat is the purpose of a protein ‘sorting signal’? What are some examples of common sorting signals and their corresponding destinations?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education