Select the sequences relevant to eukaryotic translation AGGAGG (Shine-Dalgarno sequence) AUG start codon TATAA/TAAR (TATA box) at -30 TATAAT at -10 TTGACA at -35 A/GNNAUGG (Kozak sequence)

Q: Does an athlete need additional vitamins for optimal performance? Explain.

A: Vitamins and minerals are essential for body functioning. The deficiency of vitamins and minerals…

Q: C6H8      +     O2      ------à     CO2      +      H2O   How many grams of C6H8 are needed to…

A: The mole concept is the part of chemistry that deals with the number of moles of a reactant that…

Q: What is triticale  ?

A: Hybrid plants are produced when plant breeders intentionally cross-pollinate the two different…

Q: Biosafety level requirement to identify presence or absence of covid-19

A: Covid-19 is caused by corona virus.Corona virus is define as virus which is responsible for…

Q: What is hyperglycaemia?

A: BASIC INFORMATION  DISEASE It is basically the illness of the body. This affects our bodily…

Q: What is Tetanu?

A: Answer: Introduction: Tetanus is an infection is caused by a toxin produced by Clostridium tetani…

Q: To explain: How the loss of AP3 causes a defect in melanosomes.

A: Pigment is a material that changes the colour of transmitted light due to selective wavelength…

Q: What determines plasma levels of 1,25(OH)2D3?

A: In blood, plasma is a body fluid which is yellowish clear liquid part of the blood in which forty…

Q: Sive the two secondary structures present in the figure?

A:

Q: Molecular detail of spike Y453F

A: Spike proteins play a vital role in however these viruses infect their hosts. See all our coverage…

Q: Why are nerve cells particularly sensitive to changes in bloodglucose concentration?

A: Ans: The glucose is transported to different parts of the body by diverse mechanisms or by receptors…

Q: Tina needs 2800 calories a day to support her energy needs during training. She tends to focus more…

A: Introduction Nutrition:- It is the process of taking in food and converting it into energy for…

Q: What is the normal cholesterol level in human blood?

A: The blood is a fluid connective tissue formed of liquid portion plasma, and the solid portion called…

Q: Is cholesterol synthesis increased or decreased in response to high dietary intake of cholesterol?

A: Cholesterol is an organic molecule that belongs to the class of lipids. It is an essential for the…

Q: Question 168cm and 57kg. What is the BMI?

A: Introduction The BMI is defined as the body mass index of a person and is found by dividing a…

Q: Activity of pesin in the blood at pH 7.4

A: It is pepsin, found in the stomach.

Q: Why edema is present in protein deficiency?

A: Introduction: Proteins are the significant nutrients for human beings that have a role in important…

Q: Describe how a cholesterol stone forms.

A: The gallstone blockage may cause episodes of discomfort in the upper right abdominal quadrant. This…

Q: Does "end A" represent the plus or the minus end? Explain. "A" End

A: End pA represent the plus end.

Q: What is xaxim?

A: Pteridophtyes are a phylum of plants. They are the vascular plants (those having xylem and phloem…

Q: discuss the metabolic defects that causes phenylketonuria and the strategies used to diagnose and…

A: Phenylketonuria is an autosomal recessive disorder, 1 mutated gene is inherited from each of the…

Q: 11. Express the Haworth projection of glucose. Show its alpha and beta and H H- -ОН HO- -H H- -OH H-…

A: Haworth projection is a way of representing monosaccharides in a cyclic ring structure in a…

Q: Differentiate between hypocotyl and epicotyl.

A: A seed is considered as a part of a seed plant that emerges into a new plant. Moreover, seeds are…

Q: Define lipotropin

A: Lipotropin is a term given to the hormones formed as a result of cleavage of pro-opiomelanocortin…

Q: Explain the synthesis steps for the major metabolic hormone in the human body. (max 9sentences)

A: We know that Protein is a biopolymer made of amino acid units. Amino acids are comprised of carbon,…

Q: nal misfolded amyloid fibril

A: Protein misfolding may be a common cellular event which will occur throughout the time period of a…

Q: escribe the general overall structure of plasma lipoprotein

A: Plasma lipoproteins are the complex aggregates of lipids and proteins that render the hydrophobic…

Q: Pentose phosphate pathway and hemolytic anemia. Explain the relationship.

A: Pentose phosphate pathway uses glucose-6-phosphate to produce ribose-5-phosphate, which can be used…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: What is hyperglycaemia?

A:

Q: Why is cholesterol an important steroid?

A: Cholesterol is a fatty substance that is synthesized by the liver and is circulated in the blood.…

Q: Name the functions, food sources, and deficiency and toxicity symptoms for vitamin B6.

A: Pyridoxine, or vitamin B6, is a water-soluble vitamin that is a member of the B-complex vitamin…

Q: Based on the F-actin assembly data presented above, which type of actin-binding protein is Protein…

A: F- actin is a crucial protein for cellular  function and responsible for cell stability. Actin…

Q: List other diseases that are associated with increased levels of plasma lipids

A: Fatty, waxy, or oily compounds are referred to as lipids. They are soluble in organic solvents but…

Q: 7. You have two preparations of hemoglobin. Preparation A has an A417/A280 ratio of 1.3, and…

A: Spectroscopy is a technique for the analytical study of molecule structure, composition, purity…

Q: B-subunit Histidine 146 NH + H ÓH NH, Aspartate 94 H2N Which statement concerning NH2 this salt…

A: Hemoglobin is an oxygen transport protein that is found in the cytoplasm of red blood cells.…

Q: what degrees of 2,3 bisPhosphoGlycerate effects

A: 2,3 bisPhosphoGlycerate is found in red blood cells or erythrocytes.

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.